ID: 1151099688

View in Genome Browser
Species Human (GRCh38)
Location 17:71542736-71542758
Sequence AGAGACACCCCCCTCTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151099688_1151099692 -5 Left 1151099688 17:71542736-71542758 CCACCCAAGAGGGGGGTGTCTCT No data
Right 1151099692 17:71542754-71542776 TCTCTAAATAAAGGAAATGCTGG No data
1151099688_1151099693 -4 Left 1151099688 17:71542736-71542758 CCACCCAAGAGGGGGGTGTCTCT No data
Right 1151099693 17:71542755-71542777 CTCTAAATAAAGGAAATGCTGGG No data
1151099688_1151099694 12 Left 1151099688 17:71542736-71542758 CCACCCAAGAGGGGGGTGTCTCT No data
Right 1151099694 17:71542771-71542793 TGCTGGGTGATGAAAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151099688 Original CRISPR AGAGACACCCCCCTCTTGGG TGG (reversed) Intergenic
No off target data available for this crispr