ID: 1151102530

View in Genome Browser
Species Human (GRCh38)
Location 17:71572328-71572350
Sequence GCCAAAAGTGTCTCCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151102527_1151102530 23 Left 1151102527 17:71572282-71572304 CCTGTGTCTTTTACGATGGTTGG No data
Right 1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG No data
1151102529_1151102530 -8 Left 1151102529 17:71572313-71572335 CCTGCAGTTGTGACAGCCAAAAG No data
Right 1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151102530 Original CRISPR GCCAAAAGTGTCTCCAAACA TGG Intergenic
No off target data available for this crispr