ID: 1151104236

View in Genome Browser
Species Human (GRCh38)
Location 17:71594004-71594026
Sequence CTGTATACACTGTTGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151104231_1151104236 -2 Left 1151104231 17:71593983-71594005 CCTTTTACAACCCGCTAACCTCT No data
Right 1151104236 17:71594004-71594026 CTGTATACACTGTTGGTCCATGG No data
1151104230_1151104236 4 Left 1151104230 17:71593977-71593999 CCAAAGCCTTTTACAACCCGCTA No data
Right 1151104236 17:71594004-71594026 CTGTATACACTGTTGGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151104236 Original CRISPR CTGTATACACTGTTGGTCCA TGG Intergenic
No off target data available for this crispr