ID: 1151107003

View in Genome Browser
Species Human (GRCh38)
Location 17:71626589-71626611
Sequence ATGAAGGTGGGTCTCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151106999_1151107003 -5 Left 1151106999 17:71626571-71626593 CCAGAGTTAGAAGAGGTCATGAA No data
Right 1151107003 17:71626589-71626611 ATGAAGGTGGGTCTCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151107003 Original CRISPR ATGAAGGTGGGTCTCCATGT TGG Intergenic
No off target data available for this crispr