ID: 1151112867

View in Genome Browser
Species Human (GRCh38)
Location 17:71700163-71700185
Sequence CTAGTACTCCATTTTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151112865_1151112867 12 Left 1151112865 17:71700128-71700150 CCATTTTCACATTATGTCTCATA No data
Right 1151112867 17:71700163-71700185 CTAGTACTCCATTTTTATATGGG No data
1151112864_1151112867 13 Left 1151112864 17:71700127-71700149 CCCATTTTCACATTATGTCTCAT No data
Right 1151112867 17:71700163-71700185 CTAGTACTCCATTTTTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151112867 Original CRISPR CTAGTACTCCATTTTTATAT GGG Intergenic
No off target data available for this crispr