ID: 1151114636

View in Genome Browser
Species Human (GRCh38)
Location 17:71721705-71721727
Sequence CTGCGTATACAGAGTAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151114631_1151114636 29 Left 1151114631 17:71721653-71721675 CCTTCCTATGTAATGGGCAAGTG No data
Right 1151114636 17:71721705-71721727 CTGCGTATACAGAGTAAGCTGGG No data
1151114633_1151114636 6 Left 1151114633 17:71721676-71721698 CCAGTGTTCTCTTTATGCTACAG No data
Right 1151114636 17:71721705-71721727 CTGCGTATACAGAGTAAGCTGGG No data
1151114632_1151114636 25 Left 1151114632 17:71721657-71721679 CCTATGTAATGGGCAAGTGCCAG No data
Right 1151114636 17:71721705-71721727 CTGCGTATACAGAGTAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151114636 Original CRISPR CTGCGTATACAGAGTAAGCT GGG Intergenic
No off target data available for this crispr