ID: 1151129564

View in Genome Browser
Species Human (GRCh38)
Location 17:71882413-71882435
Sequence AACCCCATGCAGTGACCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151129562_1151129564 19 Left 1151129562 17:71882371-71882393 CCAAGGAAATAAAGGACAATTTT No data
Right 1151129564 17:71882413-71882435 AACCCCATGCAGTGACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151129564 Original CRISPR AACCCCATGCAGTGACCAAG TGG Intergenic
No off target data available for this crispr