ID: 1151130674

View in Genome Browser
Species Human (GRCh38)
Location 17:71893446-71893468
Sequence CACATTAGGAAGTTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151130667_1151130674 18 Left 1151130667 17:71893405-71893427 CCATCTCAAAAACAAAACCAAAA 0: 18
1: 1203
2: 4293
3: 97506
4: 83760
Right 1151130674 17:71893446-71893468 CACATTAGGAAGTTTCTCACTGG No data
1151130669_1151130674 1 Left 1151130669 17:71893422-71893444 CCAAAAAAATTCCATTGGCCAAT No data
Right 1151130674 17:71893446-71893468 CACATTAGGAAGTTTCTCACTGG No data
1151130671_1151130674 -10 Left 1151130671 17:71893433-71893455 CCATTGGCCAATCCACATTAGGA No data
Right 1151130674 17:71893446-71893468 CACATTAGGAAGTTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151130674 Original CRISPR CACATTAGGAAGTTTCTCAC TGG Intergenic
No off target data available for this crispr