ID: 1151130720

View in Genome Browser
Species Human (GRCh38)
Location 17:71893761-71893783
Sequence GTGAATAATATGAGCACCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151130713_1151130720 30 Left 1151130713 17:71893708-71893730 CCCAGCAGTCTTTGTAAGCAAAG No data
Right 1151130720 17:71893761-71893783 GTGAATAATATGAGCACCCTTGG No data
1151130714_1151130720 29 Left 1151130714 17:71893709-71893731 CCAGCAGTCTTTGTAAGCAAAGA No data
Right 1151130720 17:71893761-71893783 GTGAATAATATGAGCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151130720 Original CRISPR GTGAATAATATGAGCACCCT TGG Intergenic
No off target data available for this crispr