ID: 1151131031

View in Genome Browser
Species Human (GRCh38)
Location 17:71896101-71896123
Sequence CTGTGCGGCCCCGGGGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151131031_1151131041 -6 Left 1151131031 17:71896101-71896123 CCCAATCCCCCGGGGCCGCACAG No data
Right 1151131041 17:71896118-71896140 GCACAGCAGGAGGTGACGGCAGG No data
1151131031_1151131039 -10 Left 1151131031 17:71896101-71896123 CCCAATCCCCCGGGGCCGCACAG No data
Right 1151131039 17:71896114-71896136 GGCCGCACAGCAGGAGGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151131031 Original CRISPR CTGTGCGGCCCCGGGGGATT GGG (reversed) Intergenic
No off target data available for this crispr