ID: 1151133772

View in Genome Browser
Species Human (GRCh38)
Location 17:71925165-71925187
Sequence CAGGGTGCCCAGATCGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151133767_1151133772 3 Left 1151133767 17:71925139-71925161 CCGACATGTATAAGAACAGAAGG No data
Right 1151133772 17:71925165-71925187 CAGGGTGCCCAGATCGCTGAAGG No data
1151133765_1151133772 27 Left 1151133765 17:71925115-71925137 CCAGGCTCAGGGGAGTAGGAGAG No data
Right 1151133772 17:71925165-71925187 CAGGGTGCCCAGATCGCTGAAGG No data
1151133764_1151133772 28 Left 1151133764 17:71925114-71925136 CCCAGGCTCAGGGGAGTAGGAGA No data
Right 1151133772 17:71925165-71925187 CAGGGTGCCCAGATCGCTGAAGG No data
1151133766_1151133772 4 Left 1151133766 17:71925138-71925160 CCCGACATGTATAAGAACAGAAG No data
Right 1151133772 17:71925165-71925187 CAGGGTGCCCAGATCGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151133772 Original CRISPR CAGGGTGCCCAGATCGCTGA AGG Intergenic
No off target data available for this crispr