ID: 1151138929

View in Genome Browser
Species Human (GRCh38)
Location 17:71973308-71973330
Sequence CCTTATTTGCAGAAAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151138926_1151138929 1 Left 1151138926 17:71973284-71973306 CCAGGATGAACAGACGTCTGCAG No data
Right 1151138929 17:71973308-71973330 CCTTATTTGCAGAAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151138929 Original CRISPR CCTTATTTGCAGAAAGTGTG TGG Intergenic
No off target data available for this crispr