ID: 1151140686

View in Genome Browser
Species Human (GRCh38)
Location 17:71989418-71989440
Sequence TGCTTGTCAGACACCTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151140686_1151140692 27 Left 1151140686 17:71989418-71989440 CCCACTTAGGTGTCTGACAAGCA No data
Right 1151140692 17:71989468-71989490 ACCGAAGACTGCTTCACAAGGGG No data
1151140686_1151140690 25 Left 1151140686 17:71989418-71989440 CCCACTTAGGTGTCTGACAAGCA No data
Right 1151140690 17:71989466-71989488 AAACCGAAGACTGCTTCACAAGG No data
1151140686_1151140691 26 Left 1151140686 17:71989418-71989440 CCCACTTAGGTGTCTGACAAGCA No data
Right 1151140691 17:71989467-71989489 AACCGAAGACTGCTTCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151140686 Original CRISPR TGCTTGTCAGACACCTAAGT GGG (reversed) Intergenic
No off target data available for this crispr