ID: 1151140688

View in Genome Browser
Species Human (GRCh38)
Location 17:71989441-71989463
Sequence CATGAAAGATAGTAAGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151140688_1151140691 3 Left 1151140688 17:71989441-71989463 CCTCAAACTTACTATCTTTCATG No data
Right 1151140691 17:71989467-71989489 AACCGAAGACTGCTTCACAAGGG No data
1151140688_1151140692 4 Left 1151140688 17:71989441-71989463 CCTCAAACTTACTATCTTTCATG No data
Right 1151140692 17:71989468-71989490 ACCGAAGACTGCTTCACAAGGGG No data
1151140688_1151140690 2 Left 1151140688 17:71989441-71989463 CCTCAAACTTACTATCTTTCATG No data
Right 1151140690 17:71989466-71989488 AAACCGAAGACTGCTTCACAAGG No data
1151140688_1151140694 20 Left 1151140688 17:71989441-71989463 CCTCAAACTTACTATCTTTCATG No data
Right 1151140694 17:71989484-71989506 CAAGGGGAATTAGAACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151140688 Original CRISPR CATGAAAGATAGTAAGTTTG AGG (reversed) Intergenic
No off target data available for this crispr