ID: 1151140692

View in Genome Browser
Species Human (GRCh38)
Location 17:71989468-71989490
Sequence ACCGAAGACTGCTTCACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151140688_1151140692 4 Left 1151140688 17:71989441-71989463 CCTCAAACTTACTATCTTTCATG No data
Right 1151140692 17:71989468-71989490 ACCGAAGACTGCTTCACAAGGGG No data
1151140685_1151140692 28 Left 1151140685 17:71989417-71989439 CCCCACTTAGGTGTCTGACAAGC No data
Right 1151140692 17:71989468-71989490 ACCGAAGACTGCTTCACAAGGGG No data
1151140686_1151140692 27 Left 1151140686 17:71989418-71989440 CCCACTTAGGTGTCTGACAAGCA No data
Right 1151140692 17:71989468-71989490 ACCGAAGACTGCTTCACAAGGGG No data
1151140687_1151140692 26 Left 1151140687 17:71989419-71989441 CCACTTAGGTGTCTGACAAGCAC No data
Right 1151140692 17:71989468-71989490 ACCGAAGACTGCTTCACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151140692 Original CRISPR ACCGAAGACTGCTTCACAAG GGG Intergenic
No off target data available for this crispr