ID: 1151151213

View in Genome Browser
Species Human (GRCh38)
Location 17:72088899-72088921
Sequence GCAACTAATCAGGGTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151151210_1151151213 -6 Left 1151151210 17:72088882-72088904 CCGAGCGTTTTCAACTAGCAACT No data
Right 1151151213 17:72088899-72088921 GCAACTAATCAGGGTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151151213 Original CRISPR GCAACTAATCAGGGTAAAGC AGG Intergenic
No off target data available for this crispr