ID: 1151165811

View in Genome Browser
Species Human (GRCh38)
Location 17:72202839-72202861
Sequence CAGCAGCAGCAGCAGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151165811_1151165816 -2 Left 1151165811 17:72202839-72202861 CCTCACTCCTGCTGCTGCTGCTG No data
Right 1151165816 17:72202860-72202882 TGCTGGTGGTGCTCTCTGGAAGG No data
1151165811_1151165817 10 Left 1151165811 17:72202839-72202861 CCTCACTCCTGCTGCTGCTGCTG No data
Right 1151165817 17:72202872-72202894 TCTCTGGAAGGCTGCCGAGTTGG No data
1151165811_1151165815 -6 Left 1151165811 17:72202839-72202861 CCTCACTCCTGCTGCTGCTGCTG No data
Right 1151165815 17:72202856-72202878 CTGCTGCTGGTGGTGCTCTCTGG No data
1151165811_1151165818 22 Left 1151165811 17:72202839-72202861 CCTCACTCCTGCTGCTGCTGCTG No data
Right 1151165818 17:72202884-72202906 TGCCGAGTTGGTGCAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151165811 Original CRISPR CAGCAGCAGCAGCAGGAGTG AGG (reversed) Intergenic
No off target data available for this crispr