ID: 1151166382

View in Genome Browser
Species Human (GRCh38)
Location 17:72207314-72207336
Sequence TATCCTCTGCTGATGGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151166382_1151166389 7 Left 1151166382 17:72207314-72207336 CCAACTACCATCAGCAGAGGATA No data
Right 1151166389 17:72207344-72207366 CTGTCGTGGAGCACAGGGCATGG No data
1151166382_1151166384 -7 Left 1151166382 17:72207314-72207336 CCAACTACCATCAGCAGAGGATA No data
Right 1151166384 17:72207330-72207352 GAGGATAACCCTCACTGTCGTGG No data
1151166382_1151166390 14 Left 1151166382 17:72207314-72207336 CCAACTACCATCAGCAGAGGATA No data
Right 1151166390 17:72207351-72207373 GGAGCACAGGGCATGGATTCAGG No data
1151166382_1151166388 2 Left 1151166382 17:72207314-72207336 CCAACTACCATCAGCAGAGGATA No data
Right 1151166388 17:72207339-72207361 CCTCACTGTCGTGGAGCACAGGG No data
1151166382_1151166386 1 Left 1151166382 17:72207314-72207336 CCAACTACCATCAGCAGAGGATA No data
Right 1151166386 17:72207338-72207360 CCCTCACTGTCGTGGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151166382 Original CRISPR TATCCTCTGCTGATGGTAGT TGG (reversed) Intergenic
No off target data available for this crispr