ID: 1151169683

View in Genome Browser
Species Human (GRCh38)
Location 17:72236353-72236375
Sequence CCACCCTATCTGGCCAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151169683_1151169690 14 Left 1151169683 17:72236353-72236375 CCCATTTTGGCCAGATAGGGTGG No data
Right 1151169690 17:72236390-72236412 CTGAGCACTTTTGGGAGGCCAGG No data
1151169683_1151169694 22 Left 1151169683 17:72236353-72236375 CCCATTTTGGCCAGATAGGGTGG No data
Right 1151169694 17:72236398-72236420 TTTTGGGAGGCCAGGGTGGGAGG No data
1151169683_1151169687 5 Left 1151169683 17:72236353-72236375 CCCATTTTGGCCAGATAGGGTGG No data
Right 1151169687 17:72236381-72236403 GTCTGTAATCTGAGCACTTTTGG No data
1151169683_1151169688 6 Left 1151169683 17:72236353-72236375 CCCATTTTGGCCAGATAGGGTGG No data
Right 1151169688 17:72236382-72236404 TCTGTAATCTGAGCACTTTTGGG No data
1151169683_1151169692 18 Left 1151169683 17:72236353-72236375 CCCATTTTGGCCAGATAGGGTGG No data
Right 1151169692 17:72236394-72236416 GCACTTTTGGGAGGCCAGGGTGG No data
1151169683_1151169691 15 Left 1151169683 17:72236353-72236375 CCCATTTTGGCCAGATAGGGTGG No data
Right 1151169691 17:72236391-72236413 TGAGCACTTTTGGGAGGCCAGGG No data
1151169683_1151169689 9 Left 1151169683 17:72236353-72236375 CCCATTTTGGCCAGATAGGGTGG No data
Right 1151169689 17:72236385-72236407 GTAATCTGAGCACTTTTGGGAGG No data
1151169683_1151169693 19 Left 1151169683 17:72236353-72236375 CCCATTTTGGCCAGATAGGGTGG No data
Right 1151169693 17:72236395-72236417 CACTTTTGGGAGGCCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151169683 Original CRISPR CCACCCTATCTGGCCAAAAT GGG (reversed) Intergenic