ID: 1151175047

View in Genome Browser
Species Human (GRCh38)
Location 17:72281206-72281228
Sequence CACTGCTGTTGCCTTAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151175043_1151175047 18 Left 1151175043 17:72281165-72281187 CCTTCTAACTTCTTGCAAAATGG No data
Right 1151175047 17:72281206-72281228 CACTGCTGTTGCCTTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151175047 Original CRISPR CACTGCTGTTGCCTTAGTTG AGG Intergenic
No off target data available for this crispr