ID: 1151179445

View in Genome Browser
Species Human (GRCh38)
Location 17:72315968-72315990
Sequence CTGGAGGGAAGGAGTTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151179445_1151179452 -3 Left 1151179445 17:72315968-72315990 CCTGTTCAACTCCTTCCCTCCAG No data
Right 1151179452 17:72315988-72316010 CAGAACCTCTGGAAACCACTGGG No data
1151179445_1151179451 -4 Left 1151179445 17:72315968-72315990 CCTGTTCAACTCCTTCCCTCCAG No data
Right 1151179451 17:72315987-72316009 CCAGAACCTCTGGAAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151179445 Original CRISPR CTGGAGGGAAGGAGTTGAAC AGG (reversed) Intergenic
No off target data available for this crispr