ID: 1151180542

View in Genome Browser
Species Human (GRCh38)
Location 17:72324327-72324349
Sequence GAGTGTGCAGCCACTCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151180542_1151180544 -8 Left 1151180542 17:72324327-72324349 CCATGAAGAGTGGCTGCACACTC No data
Right 1151180544 17:72324342-72324364 GCACACTCTGTGTACTAGCTGGG No data
1151180542_1151180543 -9 Left 1151180542 17:72324327-72324349 CCATGAAGAGTGGCTGCACACTC No data
Right 1151180543 17:72324341-72324363 TGCACACTCTGTGTACTAGCTGG No data
1151180542_1151180547 28 Left 1151180542 17:72324327-72324349 CCATGAAGAGTGGCTGCACACTC No data
Right 1151180547 17:72324378-72324400 AAATCATATTCGAAGAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151180542 Original CRISPR GAGTGTGCAGCCACTCTTCA TGG (reversed) Intergenic
No off target data available for this crispr