ID: 1151180544

View in Genome Browser
Species Human (GRCh38)
Location 17:72324342-72324364
Sequence GCACACTCTGTGTACTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151180536_1151180544 7 Left 1151180536 17:72324312-72324334 CCCTCCCAGAACTTCCCATGAAG No data
Right 1151180544 17:72324342-72324364 GCACACTCTGTGTACTAGCTGGG No data
1151180537_1151180544 6 Left 1151180537 17:72324313-72324335 CCTCCCAGAACTTCCCATGAAGA No data
Right 1151180544 17:72324342-72324364 GCACACTCTGTGTACTAGCTGGG No data
1151180541_1151180544 -7 Left 1151180541 17:72324326-72324348 CCCATGAAGAGTGGCTGCACACT No data
Right 1151180544 17:72324342-72324364 GCACACTCTGTGTACTAGCTGGG No data
1151180542_1151180544 -8 Left 1151180542 17:72324327-72324349 CCATGAAGAGTGGCTGCACACTC No data
Right 1151180544 17:72324342-72324364 GCACACTCTGTGTACTAGCTGGG No data
1151180535_1151180544 8 Left 1151180535 17:72324311-72324333 CCCCTCCCAGAACTTCCCATGAA No data
Right 1151180544 17:72324342-72324364 GCACACTCTGTGTACTAGCTGGG No data
1151180539_1151180544 2 Left 1151180539 17:72324317-72324339 CCAGAACTTCCCATGAAGAGTGG No data
Right 1151180544 17:72324342-72324364 GCACACTCTGTGTACTAGCTGGG No data
1151180538_1151180544 3 Left 1151180538 17:72324316-72324338 CCCAGAACTTCCCATGAAGAGTG No data
Right 1151180544 17:72324342-72324364 GCACACTCTGTGTACTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151180544 Original CRISPR GCACACTCTGTGTACTAGCT GGG Intergenic