ID: 1151180547

View in Genome Browser
Species Human (GRCh38)
Location 17:72324378-72324400
Sequence AAATCATATTCGAAGAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151180541_1151180547 29 Left 1151180541 17:72324326-72324348 CCCATGAAGAGTGGCTGCACACT No data
Right 1151180547 17:72324378-72324400 AAATCATATTCGAAGAACATTGG No data
1151180542_1151180547 28 Left 1151180542 17:72324327-72324349 CCATGAAGAGTGGCTGCACACTC No data
Right 1151180547 17:72324378-72324400 AAATCATATTCGAAGAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151180547 Original CRISPR AAATCATATTCGAAGAACAT TGG Intergenic