ID: 1151180547 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:72324378-72324400 |
Sequence | AAATCATATTCGAAGAACAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1151180541_1151180547 | 29 | Left | 1151180541 | 17:72324326-72324348 | CCCATGAAGAGTGGCTGCACACT | No data | ||
Right | 1151180547 | 17:72324378-72324400 | AAATCATATTCGAAGAACATTGG | No data | ||||
1151180542_1151180547 | 28 | Left | 1151180542 | 17:72324327-72324349 | CCATGAAGAGTGGCTGCACACTC | No data | ||
Right | 1151180547 | 17:72324378-72324400 | AAATCATATTCGAAGAACATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1151180547 | Original CRISPR | AAATCATATTCGAAGAACAT TGG | Intergenic | ||