ID: 1151181183

View in Genome Browser
Species Human (GRCh38)
Location 17:72329792-72329814
Sequence CACAGTGGCCAGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151181183_1151181190 8 Left 1151181183 17:72329792-72329814 CCATCTTCCTTCTGGCCACTGTG No data
Right 1151181190 17:72329823-72329845 GAGGAGAAGGAGAGAGACAAAGG No data
1151181183_1151181188 -5 Left 1151181183 17:72329792-72329814 CCATCTTCCTTCTGGCCACTGTG No data
Right 1151181188 17:72329810-72329832 CTGTGTTCCAGAGGAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151181183 Original CRISPR CACAGTGGCCAGAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr