ID: 1151185880

View in Genome Browser
Species Human (GRCh38)
Location 17:72363607-72363629
Sequence GTGGGGAAGCTGAGCTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151185880_1151185897 29 Left 1151185880 17:72363607-72363629 CCTTCCTAGCTCAGCTTCCCCAC No data
Right 1151185897 17:72363659-72363681 CCCACAGAAACAGCCAAGGTGGG No data
1151185880_1151185895 28 Left 1151185880 17:72363607-72363629 CCTTCCTAGCTCAGCTTCCCCAC No data
Right 1151185895 17:72363658-72363680 CCCCACAGAAACAGCCAAGGTGG No data
1151185880_1151185893 25 Left 1151185880 17:72363607-72363629 CCTTCCTAGCTCAGCTTCCCCAC No data
Right 1151185893 17:72363655-72363677 CCTCCCCACAGAAACAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151185880 Original CRISPR GTGGGGAAGCTGAGCTAGGA AGG (reversed) Intergenic
No off target data available for this crispr