ID: 1151186614

View in Genome Browser
Species Human (GRCh38)
Location 17:72369458-72369480
Sequence CAATCTGGTCCCTTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151186614_1151186623 9 Left 1151186614 17:72369458-72369480 CCCAGCTCAAAGGGACCAGATTG No data
Right 1151186623 17:72369490-72369512 GTATGGAGCAGGCTTTTTCCAGG No data
1151186614_1151186624 12 Left 1151186614 17:72369458-72369480 CCCAGCTCAAAGGGACCAGATTG No data
Right 1151186624 17:72369493-72369515 TGGAGCAGGCTTTTTCCAGGAGG No data
1151186614_1151186625 18 Left 1151186614 17:72369458-72369480 CCCAGCTCAAAGGGACCAGATTG No data
Right 1151186625 17:72369499-72369521 AGGCTTTTTCCAGGAGGAGCTGG No data
1151186614_1151186618 -8 Left 1151186614 17:72369458-72369480 CCCAGCTCAAAGGGACCAGATTG No data
Right 1151186618 17:72369473-72369495 CCAGATTGCCCCTGGAAGTATGG No data
1151186614_1151186619 -2 Left 1151186614 17:72369458-72369480 CCCAGCTCAAAGGGACCAGATTG No data
Right 1151186619 17:72369479-72369501 TGCCCCTGGAAGTATGGAGCAGG No data
1151186614_1151186627 23 Left 1151186614 17:72369458-72369480 CCCAGCTCAAAGGGACCAGATTG No data
Right 1151186627 17:72369504-72369526 TTTTCCAGGAGGAGCTGGAAGGG No data
1151186614_1151186626 22 Left 1151186614 17:72369458-72369480 CCCAGCTCAAAGGGACCAGATTG No data
Right 1151186626 17:72369503-72369525 TTTTTCCAGGAGGAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151186614 Original CRISPR CAATCTGGTCCCTTTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr