ID: 1151188843

View in Genome Browser
Species Human (GRCh38)
Location 17:72383076-72383098
Sequence CATCCTTGACCCACTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 187}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151188843_1151188849 -3 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188849 17:72383096-72383118 ATGCGCAGACGCAGCTCCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1151188843_1151188850 3 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188850 17:72383102-72383124 AGACGCAGCTCCCGGGGCCTAGG 0: 1
1: 0
2: 0
3: 11
4: 182
1151188843_1151188860 21 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188860 17:72383120-72383142 CTAGGAGCCCCGGGAGGGCGGGG 0: 1
1: 1
2: 0
3: 38
4: 369
1151188843_1151188859 20 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188859 17:72383119-72383141 CCTAGGAGCCCCGGGAGGGCGGG 0: 1
1: 0
2: 2
3: 54
4: 475
1151188843_1151188851 11 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188851 17:72383110-72383132 CTCCCGGGGCCTAGGAGCCCCGG 0: 1
1: 0
2: 1
3: 20
4: 261
1151188843_1151188847 -5 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188847 17:72383094-72383116 GGATGCGCAGACGCAGCTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 112
1151188843_1151188852 12 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188852 17:72383111-72383133 TCCCGGGGCCTAGGAGCCCCGGG 0: 1
1: 1
2: 1
3: 20
4: 248
1151188843_1151188864 30 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188864 17:72383129-72383151 CCGGGAGGGCGGGGCTTTGATGG 0: 1
1: 0
2: 1
3: 18
4: 244
1151188843_1151188856 16 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188856 17:72383115-72383137 GGGGCCTAGGAGCCCCGGGAGGG 0: 1
1: 0
2: 3
3: 30
4: 303
1151188843_1151188848 -4 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188848 17:72383095-72383117 GATGCGCAGACGCAGCTCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 117
1151188843_1151188857 19 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188857 17:72383118-72383140 GCCTAGGAGCCCCGGGAGGGCGG 0: 1
1: 0
2: 2
3: 39
4: 361
1151188843_1151188855 15 Left 1151188843 17:72383076-72383098 CCCCCAGGAGTGGGTCAAGGATG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1151188855 17:72383114-72383136 CGGGGCCTAGGAGCCCCGGGAGG 0: 1
1: 0
2: 0
3: 26
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151188843 Original CRISPR CATCCTTGACCCACTCCTGG GGG (reversed) Intergenic
901963572 1:12847473-12847495 CATCCTTGATCAACTCCAGCTGG + Exonic
901980926 1:13033458-13033480 GAACCATGAACCACTCCTGGAGG + Intronic
901984324 1:13062119-13062141 CATCCTTGATCAACTCCAGCTGG - Exonic
901997486 1:13164651-13164673 CATCCTTGATCAACTCCAGCTGG + Exonic
902001161 1:13195472-13195494 GAACCATGAACCACTCCTGGAGG - Intergenic
902020394 1:13341176-13341198 GAACCATGAACCACTCCTGGAGG - Intergenic
903337798 1:22636616-22636638 CAGCCTGGAGCCACTCCTGCTGG + Exonic
904412286 1:30331705-30331727 CGTCCTTGAACCATTCCTGCTGG + Intergenic
904533493 1:31183964-31183986 CATCCCTGCACCGCTCCTGGTGG - Exonic
905554075 1:38868152-38868174 TATCCTTGTCCCACTCCAGCTGG - Intronic
906150579 1:43585206-43585228 CATCCTCCACCCACTGCTGCAGG - Intronic
906281058 1:44554180-44554202 CATCCTTCCTCCATTCCTGGGGG - Intronic
908511616 1:64854223-64854245 CTTCCTCTGCCCACTCCTGGTGG + Intronic
911053775 1:93694144-93694166 CAGCCTTGCCCAGCTCCTGGTGG + Intronic
911450019 1:98050337-98050359 CAACCTTGAATCAATCCTGGTGG - Intergenic
912518727 1:110231315-110231337 AATCCCTGCCCCACCCCTGGTGG + Intronic
913117561 1:115711106-115711128 CCTCATGGCCCCACTCCTGGGGG + Intronic
915489669 1:156244101-156244123 CATCCCTGACCCTGTCCTGGAGG - Exonic
917051424 1:170928964-170928986 CATACCTCACCCACTTCTGGAGG + Intergenic
924404725 1:243730733-243730755 CACGCCTGACCCACTCCTTGAGG + Intronic
1069026695 10:63550186-63550208 CATCTGTAACCCAGTCCTGGTGG - Intronic
1069027703 10:63561777-63561799 CATCTGTAACCTACTCCTGGTGG - Intronic
1069924041 10:71835976-71835998 CATTCCTTACCCTCTCCTGGAGG - Intronic
1069956608 10:72055748-72055770 CATCCTTGATGCACCCCTGTGGG - Intergenic
1074599509 10:114899613-114899635 CACCCTTGAACCAATCCTGGTGG + Intronic
1076280144 10:129239759-129239781 CATCCATGGCCCACGGCTGGGGG + Intergenic
1077262832 11:1632150-1632172 CATCCCTCTCCCAATCCTGGGGG - Intergenic
1077922749 11:6654212-6654234 CATCCATGACTGTCTCCTGGGGG + Intronic
1079123318 11:17700068-17700090 CAGCCATGACCCTCTCATGGCGG + Intergenic
1083161659 11:60858213-60858235 CATCTTTCTCCCAGTCCTGGGGG - Intergenic
1084197239 11:67530460-67530482 CATCCCTGACTCACAGCTGGAGG - Intergenic
1084517707 11:69645464-69645486 CCTCCTTCACCCACCGCTGGGGG - Intronic
1084697664 11:70765275-70765297 CATCCCTGACCCAATCATGCTGG - Intronic
1084915256 11:72424277-72424299 CACCCTTGCCCCATGCCTGGGGG + Intronic
1089753072 11:120665637-120665659 AAACCTTGACCAATTCCTGGGGG - Intronic
1089986598 11:122819845-122819867 CATCTTTGATCCACTCAAGGTGG - Intergenic
1091184494 11:133635743-133635765 CATTCTTGACCCAATCCCTGAGG - Intergenic
1091701412 12:2665768-2665790 CAACCTTGAGCCCCTCCTGCAGG - Intronic
1094713229 12:32986156-32986178 CATACTTGGCCCCCTCCCGGTGG - Intergenic
1096554675 12:52395982-52396004 CATCTTTGACCCCCTCCTGGAGG + Intronic
1096777417 12:53972807-53972829 CCTCCTTCCCCCAATCCTGGGGG + Intergenic
1096803244 12:54125781-54125803 GGTCCTTGGCCCACTCCTGTTGG - Intergenic
1100701710 12:97155459-97155481 CATCCCTGAACCAATCCTTGTGG + Intergenic
1102593390 12:113974197-113974219 CATCCTCAACCCCCTCCTGCAGG + Intergenic
1102860663 12:116333579-116333601 CACCCTCGAGCCAATCCTGGTGG + Intergenic
1103764424 12:123270985-123271007 CATCCTGGTCCCAGTCCCGGCGG + Intronic
1108275534 13:48805710-48805732 CATCCTTGTATCAGTCCTGGAGG - Intergenic
1108571767 13:51758791-51758813 CCTCCCTGACCCATTCTTGGAGG + Intronic
1112188373 13:97150121-97150143 CATCCTACACTCACTGCTGGTGG + Intergenic
1114459805 14:22879103-22879125 CAGCCTAGCCCCACACCTGGTGG + Exonic
1115651360 14:35404602-35404624 CCTCCATGGCCCACTCCTGGGGG + Exonic
1117710346 14:58521904-58521926 CATCCTTGATCAACTCCAGCTGG - Intronic
1122153680 14:99737977-99737999 CCTCCTTGCCCGACGCCTGGGGG + Intronic
1123031617 14:105454490-105454512 CTTCCCCCACCCACTCCTGGTGG + Intronic
1124200278 15:27673479-27673501 CACCCTTGACTCTCTCCTGGGGG + Intergenic
1125920021 15:43519827-43519849 CATCTTTGCCCCGCTCCTAGGGG - Intronic
1127833299 15:62769663-62769685 CATCCTCCACCCTCTCCTGCTGG + Intronic
1128550970 15:68597774-68597796 CATCCTTGTCCCTCTCCCAGTGG + Intronic
1129912185 15:79237121-79237143 CATCCTTGATCAACTCCAGCTGG - Intergenic
1130065171 15:80596847-80596869 CATCACTGACCCAGTCCTGATGG - Exonic
1130860065 15:87877854-87877876 CATCCTTACAACACTCCTGGGGG - Intronic
1132317800 15:100902639-100902661 CAGCCTTGAGCCAGTCCTGTGGG + Intronic
1134068216 16:11243465-11243487 CATCCTTGATCAACTCCAGCTGG - Intergenic
1134751028 16:16625341-16625363 CATCCTTGAACCAGTCCCTGTGG + Intergenic
1134751038 16:16625384-16625406 CATCCTTGAACCAATCCCTGTGG + Intergenic
1134994418 16:18728207-18728229 CATCCTTGAACCAATCCCTGTGG - Intergenic
1134994428 16:18728250-18728272 CATCCTTGAACCAGTCCCTGTGG - Intergenic
1136120332 16:28128816-28128838 CACCCCTGGCCCACTCCTTGAGG + Intronic
1138027276 16:53531812-53531834 CAGTCATGACCCATTCCTGGGGG + Intergenic
1138214460 16:55191074-55191096 CATCCTTGAACCAATCATGGTGG - Intergenic
1139557882 16:67724161-67724183 CATCCCTGACACACCCCTGAAGG + Exonic
1139751025 16:69108906-69108928 TACCCTGCACCCACTCCTGGAGG - Intronic
1139972540 16:70785166-70785188 GGTCCTTGTTCCACTCCTGGAGG + Intronic
1140974197 16:80043608-80043630 CATCCTCAACCAACGCCTGGAGG - Intergenic
1141983766 16:87566242-87566264 CATTCTTGACACTGTCCTGGAGG - Intergenic
1142049092 16:87946382-87946404 GAACCTGGCCCCACTCCTGGAGG + Intergenic
1147587799 17:41662716-41662738 CCTCCTCCACCCACTCCTGGTGG + Intergenic
1148560361 17:48602512-48602534 CATCCTAGCCCCAAACCTGGCGG - Intronic
1150695274 17:67399435-67399457 CATTCTTTAGCCATTCCTGGGGG + Intronic
1151188843 17:72383076-72383098 CATCCTTGACCCACTCCTGGGGG - Intergenic
1152271826 17:79329368-79329390 CATCCTGGCCACACTCCTGCCGG + Intronic
1152443795 17:80328215-80328237 CATCCTAGTCCTTCTCCTGGTGG + Intronic
1152575016 17:81136203-81136225 CCTCCTGGCCCCTCTCCTGGCGG + Intronic
1154098770 18:11447938-11447960 CATCTTTGTCACATTCCTGGGGG + Intergenic
1154480280 18:14815836-14815858 ATTCCTTGATCCACTCATGGAGG - Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160816479 19:1038320-1038342 TGTCCTTGCCCCACCCCTGGGGG - Exonic
1160920117 19:1515593-1515615 CAGCCTGGACCCCCTCCTTGAGG + Intergenic
1164645340 19:29855257-29855279 CATCCCTGAGCCAGTCCCGGAGG + Intergenic
1165431905 19:35777690-35777712 CAGCCTCTACCCACTGCTGGGGG + Exonic
1167166466 19:47802965-47802987 GATTCTTGAACCACACCTGGGGG + Exonic
1167175377 19:47860795-47860817 GATTCTTGAACCACACCTGGGGG - Intergenic
925377566 2:3399094-3399116 CATCCTTGGCCCTCTGTTGGTGG + Intronic
926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG + Intergenic
927273784 2:21243069-21243091 CATCATGGGCCCACTCTTGGGGG + Intergenic
929966038 2:46537372-46537394 CATCCCTGAACCAGTCATGGTGG - Intronic
930550494 2:52828835-52828857 CATGCTTGAGACAGTCCTGGCGG + Intergenic
931177628 2:59869855-59869877 CCTCCTTGTCCCAGTCTTGGAGG - Intergenic
938790681 2:134672901-134672923 CATCTTTGGCCCAGTACTGGGGG + Intronic
939024633 2:136997569-136997591 CATCCTCTTCCCACTTCTGGTGG - Intronic
942094804 2:172526668-172526690 CATCTTTGATCCACTCAAGGTGG + Intergenic
942458788 2:176155596-176155618 CTTCCCTGGCCCACTCCTGTGGG - Intronic
943601312 2:189924129-189924151 CATCCTTGATCAACTCCAGCTGG - Intronic
948182209 2:235990905-235990927 GAACCTTGCCCCACCCCTGGTGG - Intronic
1169274951 20:4227540-4227562 CATCCATCACCAACTCCTGTTGG + Intronic
1169772981 20:9221525-9221547 CCTCCTTGCCTCACTCCTGCGGG + Intronic
1171854949 20:30335577-30335599 CGTCCTTTGCCCACTCCTGTTGG - Intergenic
1172354573 20:34270535-34270557 CATCCTGGCCTCACCCCTGGGGG - Intergenic
1172421743 20:34824741-34824763 CATCCTCCACCCCCTCTTGGGGG - Intronic
1172700790 20:36852435-36852457 GAGCCTTGACAGACTCCTGGGGG - Intronic
1174190754 20:48738734-48738756 AATCCTTGAGCCTTTCCTGGGGG - Intronic
1174219447 20:48941629-48941651 CATCCTGGACTGAATCCTGGTGG - Intronic
1174761688 20:53212853-53212875 CATCCCTGGACCACTCCTTGGGG + Intronic
1175224068 20:57434592-57434614 CTTCCTTAACCCACTGCTGGGGG - Intergenic
1180972206 22:19821603-19821625 CACCCTTCCCCCACTGCTGGGGG + Intronic
1183301226 22:37060113-37060135 CATCCTGGACCCAGTGCTGTGGG + Intronic
1183434179 22:37783724-37783746 CATCCATGTCACACTGCTGGTGG - Intergenic
950569947 3:13793602-13793624 CTGCCCTGACCCACTCTTGGTGG + Intergenic
950840582 3:15964634-15964656 TCTCCTTGAACCACTCCGGGTGG + Intergenic
954638126 3:52082520-52082542 CATTGTTCACCCTCTCCTGGGGG - Intronic
955046714 3:55367871-55367893 CATCCTCGAACCAATCCCGGGGG - Intergenic
957862437 3:85972437-85972459 CATCCTGGGACCACCCCTGGGGG + Intronic
961366343 3:126402185-126402207 CATCACTAACCCAGTCCTGGGGG + Intronic
961469139 3:127100601-127100623 CATCCCTGGCCCACTGCTGACGG + Intergenic
962754988 3:138459965-138459987 CATCCTGGAGCCCCTCCTAGTGG + Exonic
966616549 3:181919591-181919613 CATCTTTGTCCCAGTACTGGTGG - Intergenic
966935527 3:184706274-184706296 TGTCTTTGACCCACTCCAGGTGG + Intergenic
968047168 3:195630945-195630967 CCTCCGTGACCCAGCCCTGGAGG + Intergenic
968307479 3:197659099-197659121 CCTCCGTGACCCAGCCCTGGAGG - Intergenic
969349268 4:6588919-6588941 CATCCTTGAACCACTGAGGGAGG + Intronic
973769279 4:54191748-54191770 CATTCTTGATCCATTCCTTGTGG - Intronic
974465402 4:62249237-62249259 TATTATTTACCCACTCCTGGAGG + Intergenic
975149968 4:71009911-71009933 CATCCTTGATCTATTCCTTGAGG + Intronic
977427471 4:96886497-96886519 CATCCTTGACCCAATTATTGTGG - Intergenic
980321902 4:131290637-131290659 TTTCCTTGATCCACTCCAGGTGG + Intergenic
983461286 4:168028176-168028198 CCTGCTTGACCCACTCCTCCGGG - Intergenic
984700170 4:182814024-182814046 CATCCTGGACCCTCTGATGGAGG - Intergenic
985609009 5:876190-876212 CATCCTTCACAAACTCCTGCAGG + Exonic
986208382 5:5647463-5647485 AATCCTTGGCTCAATCCTGGAGG - Intergenic
986917561 5:12640931-12640953 CAACCTTGACCCAATGCTGTTGG + Intergenic
987418210 5:17687323-17687345 CCTCCCAGACCTACTCCTGGTGG - Intergenic
988556303 5:32239054-32239076 CACCCATGACCCACTCCTTTTGG + Exonic
991156329 5:63440685-63440707 CTCCCTTGACCCCCTCCTGTTGG + Intergenic
992018691 5:72600960-72600982 CATCATTGAACCACTCCTCAAGG - Intergenic
992269527 5:75051519-75051541 CATCCTTGACCCACGGGTGCTGG - Intergenic
998030278 5:138860905-138860927 CATCCTCGGCACACTCCTGCAGG - Intronic
998037587 5:138929993-138930015 CATACTTGAGCAACACCTGGAGG - Intronic
998983906 5:147734076-147734098 TATCCTTCACCCACTGTTGGTGG - Intronic
999125874 5:149245360-149245382 CATCCTTGCCACCCTCCTGATGG - Intronic
999178282 5:149647546-149647568 CAGCCTTGACACAATTCTGGGGG - Intergenic
1001842704 5:174892804-174892826 TGTCTTTGATCCACTCCTGGTGG - Intergenic
1002417338 5:179127354-179127376 CATGCTGGGCCCACACCTGGAGG - Intronic
1005494915 6:26379943-26379965 CATCCTAGACCCAGTCCATGTGG - Intergenic
1007389286 6:41541048-41541070 CAGCCTCGCCCCAGTCCTGGGGG + Intergenic
1007950375 6:45866846-45866868 CAGCCTTCACCCTCTCCTGATGG - Intergenic
1011699796 6:89945051-89945073 GATCCTTGATACACTGCTGGTGG + Intronic
1011750389 6:90449344-90449366 CATCTTTCATCCACTCCAGGAGG - Intergenic
1014028531 6:116675911-116675933 CATCCCTGACCTCTTCCTGGAGG - Intergenic
1015799311 6:137044604-137044626 CATCCCCGACCCGCACCTGGCGG + Intronic
1016337837 6:143027078-143027100 GTTCCTTGAACCACCCCTGGAGG - Intergenic
1017068205 6:150549397-150549419 CATCCTTCAGACACTCATGGAGG - Intergenic
1019131508 6:169880478-169880500 CATACATCACCCACACCTGGTGG + Intergenic
1019183419 6:170207257-170207279 CATCCCTGTGCCACTCCTGCAGG - Intergenic
1019522947 7:1468792-1468814 CATCCACGCCCCACCCCTGGGGG + Intergenic
1019989829 7:4683165-4683187 CAGCCCTGACCCACACCTTGCGG + Intronic
1020751537 7:12147330-12147352 CATCTCTGACTCACTCATGGTGG + Intergenic
1023253783 7:38292320-38292342 CATCCCTGCCCCACCCCTAGAGG - Intergenic
1024950987 7:54860232-54860254 CAACCCTGCCCCACTCCAGGAGG - Intergenic
1030907700 7:115206844-115206866 GACCCTTGACCCAGCCCTGGAGG + Intergenic
1031519280 7:122743579-122743601 CACCCATGCCCCAATCCTGGAGG - Intronic
1033099142 7:138455787-138455809 GACCCTTGACTCGCTCCTGGGGG - Intergenic
1036165668 8:6430444-6430466 CATCCCTGACCCCCTTCTGAGGG - Intronic
1037486843 8:19356113-19356135 CCTCCTTCACACACTCCTGCAGG - Intronic
1037609513 8:20464422-20464444 CATCCTAGTCCCAACCCTGGTGG + Intergenic
1038751522 8:30300482-30300504 CATCTTTGACCCAATCCCTGGGG - Intergenic
1046838458 8:118829538-118829560 CATCCTTCACCCACTTTTTGAGG - Intergenic
1047618744 8:126585200-126585222 CATCCTTGAGGGACTCCTCGTGG - Intergenic
1048019836 8:130527991-130528013 CACCCCTCCCCCACTCCTGGTGG - Intergenic
1049547513 8:143240383-143240405 CGTGCTTGACTCACTGCTGGTGG - Intergenic
1052232200 9:26167088-26167110 CTTCCTTGAGCCCCTCATGGAGG - Intergenic
1054840177 9:69730206-69730228 CTTCCTTGACCCGCCCTTGGAGG - Intronic
1055401702 9:75930886-75930908 CCTCCTTAAAACACTCCTGGAGG + Intronic
1055626048 9:78178579-78178601 CATACTTGGCCCCCTCCTGCTGG - Intergenic
1057781430 9:98054037-98054059 CATCTTTGATCCACTCAAGGTGG + Intergenic
1060053874 9:120396706-120396728 CACCATTTACCCACTCATGGTGG + Intronic
1060526466 9:124323914-124323936 CATCCTAGACTCAATCCTGCTGG - Intronic
1060885538 9:127149593-127149615 GATCCTTAATCCAGTCCTGGAGG - Intronic
1062186724 9:135222252-135222274 CATCCTGCCCCCTCTCCTGGGGG + Intergenic
1062711700 9:137978329-137978351 CACCCTTCACTCCCTCCTGGGGG - Intronic
1203574713 Un_KI270744v1:166398-166420 CATGCTTTACCCACTCTTTGGGG - Intergenic
1187012013 X:15289171-15289193 CATCTTTGAACCCCTCATGGGGG - Intronic
1189322711 X:40096326-40096348 CATTCTACACCCACCCCTGGGGG + Intronic
1197081741 X:122426401-122426423 TATCCTTGCCCCCCACCTGGTGG - Intergenic
1199119332 X:144032531-144032553 CATCCTTGACCCTCTCATCATGG - Intergenic
1199259801 X:145759224-145759246 TATCCTTGGCCAACTCCTGTTGG + Intergenic
1199987889 X:152965362-152965384 CAGCCCTGAACCACTCCTGTGGG + Intronic