ID: 1151192504

View in Genome Browser
Species Human (GRCh38)
Location 17:72408718-72408740
Sequence CCACTACCCTTCCCGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151192501_1151192504 14 Left 1151192501 17:72408681-72408703 CCAGAACTGTGAAAGAATGAATT 0: 4
1: 74
2: 541
3: 2144
4: 4450
Right 1151192504 17:72408718-72408740 CCACTACCCTTCCCGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151192504 Original CRISPR CCACTACCCTTCCCGAAGGC AGG Intergenic
No off target data available for this crispr