ID: 1151193195

View in Genome Browser
Species Human (GRCh38)
Location 17:72413513-72413535
Sequence TATAAGTTAATGCTTTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151193195_1151193204 30 Left 1151193195 17:72413513-72413535 CCATTGAAAAGCATTAACTTATA No data
Right 1151193204 17:72413566-72413588 ACCTGGTCCCTTGTTTGTCCCGG No data
1151193195_1151193198 13 Left 1151193195 17:72413513-72413535 CCATTGAAAAGCATTAACTTATA No data
Right 1151193198 17:72413549-72413571 CCCTCCCGAACCAGCCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151193195 Original CRISPR TATAAGTTAATGCTTTTCAA TGG (reversed) Intergenic
No off target data available for this crispr