ID: 1151193197

View in Genome Browser
Species Human (GRCh38)
Location 17:72413549-72413571
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151193197_1151193206 -3 Left 1151193197 17:72413549-72413571 CCCTCCCGAACCAGCCGACCTGG No data
Right 1151193206 17:72413569-72413591 TGGTCCCTTGTTTGTCCCGGTGG No data
1151193197_1151193204 -6 Left 1151193197 17:72413549-72413571 CCCTCCCGAACCAGCCGACCTGG No data
Right 1151193204 17:72413566-72413588 ACCTGGTCCCTTGTTTGTCCCGG No data
1151193197_1151193211 14 Left 1151193197 17:72413549-72413571 CCCTCCCGAACCAGCCGACCTGG No data
Right 1151193211 17:72413586-72413608 CGGTGGACTGTGCCAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151193197 Original CRISPR CCAGGTCGGCTGGTTCGGGA GGG (reversed) Intergenic
No off target data available for this crispr