ID: 1151193204

View in Genome Browser
Species Human (GRCh38)
Location 17:72413566-72413588
Sequence ACCTGGTCCCTTGTTTGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151193195_1151193204 30 Left 1151193195 17:72413513-72413535 CCATTGAAAAGCATTAACTTATA No data
Right 1151193204 17:72413566-72413588 ACCTGGTCCCTTGTTTGTCCCGG No data
1151193200_1151193204 -10 Left 1151193200 17:72413553-72413575 CCCGAACCAGCCGACCTGGTCCC No data
Right 1151193204 17:72413566-72413588 ACCTGGTCCCTTGTTTGTCCCGG No data
1151193199_1151193204 -7 Left 1151193199 17:72413550-72413572 CCTCCCGAACCAGCCGACCTGGT No data
Right 1151193204 17:72413566-72413588 ACCTGGTCCCTTGTTTGTCCCGG No data
1151193197_1151193204 -6 Left 1151193197 17:72413549-72413571 CCCTCCCGAACCAGCCGACCTGG No data
Right 1151193204 17:72413566-72413588 ACCTGGTCCCTTGTTTGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151193204 Original CRISPR ACCTGGTCCCTTGTTTGTCC CGG Intergenic
No off target data available for this crispr