ID: 1151194180

View in Genome Browser
Species Human (GRCh38)
Location 17:72420260-72420282
Sequence GCAGTTCGATGGCTTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151194172_1151194180 9 Left 1151194172 17:72420228-72420250 CCCACTTTACAGATGGGGAAAAC No data
Right 1151194180 17:72420260-72420282 GCAGTTCGATGGCTTGCTCAGGG No data
1151194173_1151194180 8 Left 1151194173 17:72420229-72420251 CCACTTTACAGATGGGGAAAACT No data
Right 1151194180 17:72420260-72420282 GCAGTTCGATGGCTTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151194180 Original CRISPR GCAGTTCGATGGCTTGCTCA GGG Intergenic