ID: 1151205728

View in Genome Browser
Species Human (GRCh38)
Location 17:72505372-72505394
Sequence TTTATAAATTACCCAGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51796
Summary {0: 6401, 1: 13084, 2: 14111, 3: 11019, 4: 7181}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151205728_1151205732 13 Left 1151205728 17:72505372-72505394 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1151205732 17:72505408-72505430 AATGGAGGCACAATTCCATGTGG No data
1151205728_1151205735 19 Left 1151205728 17:72505372-72505394 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1151205735 17:72505414-72505436 GGCACAATTCCATGTGGCTGGGG No data
1151205728_1151205733 17 Left 1151205728 17:72505372-72505394 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1151205733 17:72505412-72505434 GAGGCACAATTCCATGTGGCTGG No data
1151205728_1151205730 -5 Left 1151205728 17:72505372-72505394 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1151205730 17:72505390-72505412 ATAAAGAAAAAGAGGTTTAATGG 0: 1338
1: 1566
2: 1040
3: 923
4: 2126
1151205728_1151205736 22 Left 1151205728 17:72505372-72505394 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1151205736 17:72505417-72505439 ACAATTCCATGTGGCTGGGGAGG 0: 21
1: 677
2: 2134
3: 6384
4: 7183
1151205728_1151205731 -2 Left 1151205728 17:72505372-72505394 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1151205731 17:72505393-72505415 AAGAAAAAGAGGTTTAATGGAGG No data
1151205728_1151205734 18 Left 1151205728 17:72505372-72505394 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1151205734 17:72505413-72505435 AGGCACAATTCCATGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151205728 Original CRISPR TTTATAAATTACCCAGTCTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr