ID: 1151207769

View in Genome Browser
Species Human (GRCh38)
Location 17:72520826-72520848
Sequence GGTGTCTCGGGTGCTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151207769_1151207780 24 Left 1151207769 17:72520826-72520848 CCAGGAGAAGCACCCGAGACACC No data
Right 1151207780 17:72520873-72520895 CCTCACTAAGCAACTTGATATGG No data
1151207769_1151207773 -2 Left 1151207769 17:72520826-72520848 CCAGGAGAAGCACCCGAGACACC No data
Right 1151207773 17:72520847-72520869 CCCCCAGCTCTCTGAGACCTTGG No data
1151207769_1151207777 1 Left 1151207769 17:72520826-72520848 CCAGGAGAAGCACCCGAGACACC No data
Right 1151207777 17:72520850-72520872 CCAGCTCTCTGAGACCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151207769 Original CRISPR GGTGTCTCGGGTGCTTCTCC TGG (reversed) Intergenic
No off target data available for this crispr