ID: 1151209843

View in Genome Browser
Species Human (GRCh38)
Location 17:72536386-72536408
Sequence GCACAGACTCCTGCCTGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151209842_1151209843 -1 Left 1151209842 17:72536364-72536386 CCAAGCATGCAGGGAGGTCTCAG No data
Right 1151209843 17:72536386-72536408 GCACAGACTCCTGCCTGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151209843 Original CRISPR GCACAGACTCCTGCCTGTGA CGG Intergenic