ID: 1151217769

View in Genome Browser
Species Human (GRCh38)
Location 17:72589490-72589512
Sequence CTGGGTTCCCACTTTTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151217759_1151217769 23 Left 1151217759 17:72589444-72589466 CCAATTTCAAACCTCCTCCTGAA No data
Right 1151217769 17:72589490-72589512 CTGGGTTCCCACTTTTTACAAGG No data
1151217761_1151217769 12 Left 1151217761 17:72589455-72589477 CCTCCTCCTGAACAAAGGCTGTC No data
Right 1151217769 17:72589490-72589512 CTGGGTTCCCACTTTTTACAAGG No data
1151217763_1151217769 6 Left 1151217763 17:72589461-72589483 CCTGAACAAAGGCTGTCTTCTCT No data
Right 1151217769 17:72589490-72589512 CTGGGTTCCCACTTTTTACAAGG No data
1151217762_1151217769 9 Left 1151217762 17:72589458-72589480 CCTCCTGAACAAAGGCTGTCTTC No data
Right 1151217769 17:72589490-72589512 CTGGGTTCCCACTTTTTACAAGG No data
1151217758_1151217769 24 Left 1151217758 17:72589443-72589465 CCCAATTTCAAACCTCCTCCTGA No data
Right 1151217769 17:72589490-72589512 CTGGGTTCCCACTTTTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151217769 Original CRISPR CTGGGTTCCCACTTTTTACA AGG Intergenic
No off target data available for this crispr