ID: 1151218254

View in Genome Browser
Species Human (GRCh38)
Location 17:72592392-72592414
Sequence CTCGCGGAGGTCGCGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151218240_1151218254 20 Left 1151218240 17:72592349-72592371 CCAAGGCCAAAGAGCAGCCAGAC 0: 1
1: 0
2: 2
3: 24
4: 265
Right 1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 141
1151218246_1151218254 -8 Left 1151218246 17:72592377-72592399 CCTCTGCGCTCCAGACTCGCGGA 0: 1
1: 0
2: 7
3: 284
4: 12527
Right 1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 141
1151218239_1151218254 24 Left 1151218239 17:72592345-72592367 CCATCCAAGGCCAAAGAGCAGCC 0: 1
1: 0
2: 3
3: 15
4: 207
Right 1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 141
1151218243_1151218254 -2 Left 1151218243 17:72592371-72592393 CCCTGTCCTCTGCGCTCCAGACT 0: 1
1: 0
2: 1
3: 37
4: 309
Right 1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 141
1151218242_1151218254 3 Left 1151218242 17:72592366-72592388 CCAGACCCTGTCCTCTGCGCTCC 0: 1
1: 0
2: 4
3: 44
4: 833
Right 1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 141
1151218244_1151218254 -3 Left 1151218244 17:72592372-72592394 CCTGTCCTCTGCGCTCCAGACTC 0: 1
1: 0
2: 7
3: 47
4: 365
Right 1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 141
1151218241_1151218254 14 Left 1151218241 17:72592355-72592377 CCAAAGAGCAGCCAGACCCTGTC 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151218254 Original CRISPR CTCGCGGAGGTCGCGGGCGG GGG Intergenic
900349665 1:2228488-2228510 CGCGCGGGGGGCCCGGGCGGCGG + Intergenic
900414681 1:2529530-2529552 TTGGCGGAGAGCGCGGGCGGGGG + Exonic
900786769 1:4654656-4654678 GGCGCGGTGGGCGCGGGCGGCGG + Intergenic
905789796 1:40783966-40783988 CCCGGGGCGGGCGCGGGCGGCGG - Intergenic
905981977 1:42237130-42237152 CTCTCGGAGGCCGAGGGGGGTGG + Intronic
910470607 1:87548427-87548449 CTTTGGGAGGTCGAGGGCGGTGG - Intergenic
911725439 1:101237114-101237136 ATGGCGGGGGTCGCGGGCGCGGG + Intronic
915238401 1:154502254-154502276 CTCTCGGAGGCGGCGGGCGCCGG + Intronic
917433922 1:174999962-174999984 CTCGCGGTGGGCGGTGGCGGCGG + Exonic
920190500 1:204190662-204190684 CTCCCGGAGCTCTCGGGGGGCGG + Exonic
923008002 1:230067371-230067393 CTGGCCGGGGGCGCGGGCGGCGG + Exonic
923181969 1:231528560-231528582 CGCGCGGCGGTGGCGGGTGGTGG + Intergenic
923744344 1:236686582-236686604 CCCACGGAGGCGGCGGGCGGCGG - Exonic
923783010 1:237042463-237042485 CCCGCGGAGCTCGGCGGCGGCGG - Exonic
924754868 1:246931746-246931768 GCCGGGGAGGTCGCAGGCGGCGG - Intronic
1064004897 10:11691700-11691722 CTCAGGGAGGGCGCGTGCGGTGG + Intergenic
1065140169 10:22713355-22713377 GTCCCGGCGGGCGCGGGCGGAGG - Intronic
1072913494 10:99523046-99523068 CCTGCGGGGGTCGCGGGGGGAGG + Intergenic
1072986916 10:100149015-100149037 CTCTCTGAGGGCGGGGGCGGGGG - Intergenic
1075801849 10:125159414-125159436 CGGGCGGCGGGCGCGGGCGGGGG - Intronic
1076879020 10:133230982-133231004 CGCGTCGCGGTCGCGGGCGGTGG - Exonic
1077037942 11:504273-504295 CTCGACGCGGGCGCGGGCGGGGG - Intronic
1077098572 11:810504-810526 CGGGCGGAGGTCGGGCGCGGTGG + Intronic
1077106043 11:843065-843087 CTCGGGGAGAGGGCGGGCGGGGG + Intronic
1079229789 11:18639749-18639771 CTCTGGGAGGTCGAGGCCGGTGG - Intergenic
1079450448 11:20596735-20596757 TCCGCGGAGGGCGGGGGCGGAGG + Intergenic
1080854288 11:36098348-36098370 CTTGCAGTGGTAGCGGGCGGTGG - Exonic
1083747898 11:64745340-64745362 CTAGTGGAGGTCGGGGGCGTGGG + Exonic
1083888747 11:65585349-65585371 CCCGCGGAGGTCCCGGCCGAGGG + Exonic
1084010879 11:66347705-66347727 CTGGGGGCGGTGGCGGGCGGCGG - Intergenic
1084743402 11:71153282-71153304 CTCGGGCGGGTCGGGGGCGGGGG + Intronic
1085284561 11:75351521-75351543 CTCGGCGAGGACACGGGCGGGGG - Intronic
1094641352 12:32278608-32278630 CTTTCGGAGGCCGCGGCCGGCGG + Intronic
1096337055 12:50764402-50764424 CTGGTGGGGGTCGCGCGCGGTGG + Intronic
1102934051 12:116882049-116882071 CTCGCGTGGGGCGCGGACGGAGG + Intergenic
1103348350 12:120265754-120265776 CGCGCGGCGGGCGCGGGCGCGGG - Exonic
1103764592 12:123271456-123271478 CCCGCGGAGGCCGGGGGCGGGGG - Intronic
1104892901 12:132148878-132148900 CTCACCGAGGTCGCAGGCGCGGG - Exonic
1106476335 13:30101647-30101669 CTCCCGGAGGTGGTGGGGGGTGG - Intergenic
1110219550 13:73059038-73059060 CTCGCGGAGGTCGGCGGTGGCGG + Exonic
1111657869 13:91175214-91175236 CTCGCGGAGGACGCGCCCAGCGG - Intergenic
1111951650 13:94713011-94713033 CTCCCGGAGCTCGCCGGCCGCGG + Intergenic
1115557369 14:34554100-34554122 CGCGGGGAGGTGGGGGGCGGGGG + Intergenic
1117846787 14:59920090-59920112 CACCCGGAGGTCGCCGGAGGCGG + Intronic
1118607563 14:67514989-67515011 ACCGCGGAGGGCGCGGGCGATGG - Intronic
1119046229 14:71320824-71320846 CTCGGGGACGGCGCGAGCGGGGG + Intronic
1119262610 14:73246337-73246359 CTCTGGGAGGTCGCTGCCGGCGG - Intronic
1119769823 14:77213563-77213585 CGCGCGAAGGAAGCGGGCGGGGG - Intronic
1122081509 14:99270690-99270712 CGCGCTGACGGCGCGGGCGGAGG - Intronic
1122624162 14:103075669-103075691 CCCTCGGCGGCCGCGGGCGGAGG - Intergenic
1124922340 15:34039005-34039027 CTCGGGGAGGCCGTGGGCGGCGG - Exonic
1129412227 15:75356350-75356372 CTCCAGGAGGTGGCGGGCGCTGG + Exonic
1130076707 15:80695655-80695677 CCCGAGGAGGGCGCGGGCGCGGG + Exonic
1132055837 15:98649688-98649710 CCCGCAGTGGCCGCGGGCGGCGG - Intronic
1132540917 16:509309-509331 CTCGCGGAGGCCGCTGGCTCGGG + Intronic
1132641960 16:982052-982074 CGCGCGGGGGTCGCGGTGGGGGG + Exonic
1132983735 16:2752818-2752840 CCCTCGGAGGCGGCGGGCGGAGG + Exonic
1133175759 16:4013006-4013028 CTCTCGGAGGCCGCGGCAGGAGG + Intronic
1136364789 16:29805043-29805065 CTGGGGGAGGGCGGGGGCGGGGG + Intronic
1139410088 16:66751778-66751800 GCCGCCGAGGTGGCGGGCGGCGG + Exonic
1140223242 16:73058661-73058683 CTGGCGGGGGTCGGCGGCGGCGG + Intronic
1142005984 16:87689822-87689844 CTGGCGGCGGGCGCGGGCGGCGG - Exonic
1142395283 16:89828395-89828417 GGCGCGGAGGGCGCGGGGGGCGG - Intronic
1142596406 17:1031932-1031954 CTCGCGGAGGGCGGGGAAGGAGG - Intronic
1146038444 17:29428874-29428896 CTCTGGGAGGTCGAGGGCAGAGG - Intronic
1146255864 17:31391434-31391456 GTCGCGGAGGACGCGGCCGTTGG + Intergenic
1148336038 17:46841950-46841972 CTCGCGGCGGCCGCGGACGCTGG - Intronic
1148562584 17:48614345-48614367 CTCGCCCAGGCCGCTGGCGGCGG + Exonic
1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG + Intergenic
1160719185 19:590060-590082 CCCGGGGGGGGCGCGGGCGGCGG - Exonic
1160903099 19:1438902-1438924 GCCGCGGGGGTCGCGGGCAGGGG + Intronic
1160909451 19:1468043-1468065 CTCGCTGAGGGAGCTGGCGGAGG - Exonic
1162324579 19:9991574-9991596 CTTGAGGAGGTCGCGGTAGGTGG + Intronic
1162523897 19:11196873-11196895 ATCGCGGAGGTCGGTGGTGGTGG + Intronic
1162524230 19:11197885-11197907 CTCGGGGAGGGCGCGCGGGGCGG + Intergenic
1166091574 19:40512785-40512807 CTCCTGGAGGCTGCGGGCGGCGG + Exonic
1166375127 19:42323772-42323794 CTTACGGAGGTGGCGGGCGGGGG - Exonic
1167258312 19:48443713-48443735 CGCGAGGTGGGCGCGGGCGGCGG - Exonic
1167638241 19:50667356-50667378 CTCGGGGAGGTCGGGGAGGGGGG + Exonic
1168503297 19:56911788-56911810 CTTTCGGAGGTCGAGGCCGGCGG - Intergenic
924985237 2:264384-264406 CTCGCGCACGTGGCGGGCTGTGG - Intronic
926095896 2:10080375-10080397 CGGGCGGGGGTCGCGGCCGGAGG + Exonic
927422920 2:22951968-22951990 CTCTGGGAGGTCGAGGCCGGTGG + Intergenic
928998756 2:37324900-37324922 CTCCCGGCGGGCGCGGGCCGAGG - Intergenic
931338662 2:61376579-61376601 CTCGCGGAGGTGGAGGGGTGAGG + Intronic
932765257 2:74465158-74465180 CTCGGGGAGGCCCCGGGCGACGG - Exonic
944766707 2:202871688-202871710 GGCGCGGGGCTCGCGGGCGGTGG - Intronic
947119483 2:226800023-226800045 CCCGCGGCGGGCGCAGGCGGGGG + Intergenic
947612058 2:231530545-231530567 CTGGCGGAGGACGCGGCCGTTGG + Intergenic
948438060 2:237967203-237967225 CGGGCGGAGGGCGCGGGCGGTGG + Intronic
1172409100 20:34709289-34709311 ATCAAGGAGGGCGCGGGCGGAGG - Exonic
1175248895 20:57597205-57597227 CCTGCGGAGGGCGCGGGCGGGGG + Intergenic
1175890284 20:62312895-62312917 CTGGCCGAGGTCAGGGGCGGTGG + Exonic
1176034147 20:63028237-63028259 TTAGCGGAGGGCGCTGGCGGTGG + Intergenic
1176194332 20:63830619-63830641 CCGGCGGGGGGCGCGGGCGGGGG + Intronic
1176952537 21:15064539-15064561 CTCGCGGGGGGCCGGGGCGGCGG - Intronic
1182222978 22:28773096-28773118 CTCGCGGCGGGCGCGGGCAGGGG + Intronic
1182857187 22:33528119-33528141 CTGGCAGAGGTCGGGGGGGGCGG + Intronic
1183200702 22:36384025-36384047 CTCTGGGAGGTCGAGGCCGGTGG + Intronic
1183667683 22:39254835-39254857 CATGCAGGGGTCGCGGGCGGTGG - Intergenic
1184037844 22:41926831-41926853 CTCGGGGAGGAAGCGGGGGGCGG + Intergenic
1185055396 22:48576244-48576266 GCCGCGGAGGGGGCGGGCGGGGG - Intronic
1185271626 22:49932122-49932144 CTGGTGGTGGTGGCGGGCGGGGG + Intergenic
1185343054 22:50300067-50300089 CCCCGGGAGGGCGCGGGCGGTGG - Intronic
1185394077 22:50578055-50578077 CTGGCGGGGGGCGCGGGCCGGGG - Intronic
1185398544 22:50604551-50604573 GGCGCGGCGGGCGCGGGCGGCGG - Exonic
953561139 3:43994944-43994966 CTACAGGAGGTCGTGGGCGGTGG + Intergenic
961827608 3:129606939-129606961 GTCCTGGAGGGCGCGGGCGGCGG - Intergenic
964771115 3:160225430-160225452 CGCGCGGAGGCTGCGGGAGGCGG - Intergenic
966787815 3:183636393-183636415 CTCGCAGGGGACGGGGGCGGGGG - Intronic
968332598 3:197884486-197884508 CTCTCGGAGGCCGGGCGCGGGGG - Intronic
968660181 4:1795612-1795634 CTCGCAGGGGTCAAGGGCGGTGG + Intronic
968775399 4:2536866-2536888 GGCGCGGGGGCCGCGGGCGGCGG - Intronic
972396860 4:38664766-38664788 CCCGGGCAGGGCGCGGGCGGGGG + Intronic
979546990 4:121950944-121950966 CTCTGGGACGTCGGGGGCGGGGG - Intronic
982712145 4:158768791-158768813 CACGCGGGGGACGCGGACGGGGG - Intergenic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
985068423 4:186144919-186144941 CGCGCGGCGGGCGCGGGCGCGGG + Exonic
985995623 5:3595655-3595677 CTCGCGGTGGGCGCGCGCGTCGG - Intergenic
992365449 5:76084691-76084713 CGGGCGGGGGTGGCGGGCGGGGG + Intronic
993837689 5:92835325-92835347 CTGGCGGAGGGCGGGGGCGGGGG - Intergenic
995574313 5:113513647-113513669 CGCGCTGAGGTCACGGGCGCCGG + Intergenic
998366653 5:141636826-141636848 CTGGCGGCGGCCGCGGGCGGCGG - Exonic
1002927178 6:1611322-1611344 GGGGCGGAGGGCGCGGGCGGCGG - Exonic
1010569807 6:77463351-77463373 GTCTCGGAGCCCGCGGGCGGCGG + Exonic
1012245774 6:96924457-96924479 CTCGCCGACGGCGGGGGCGGGGG + Intergenic
1014230101 6:118893978-118894000 CGCGCGGAGGCCGCCGGCGGCGG - Intronic
1014802238 6:125790560-125790582 AGCTCGGAGGTCGCGGGGGGCGG + Intronic
1018942605 6:168319461-168319483 GGCGCGGCGGGCGCGGGCGGGGG + Exonic
1019171841 6:170137170-170137192 CGCGCGGAGGTCGGGGGACGTGG - Intergenic
1019510200 7:1413981-1414003 CTGGGGGAGGTGGCGGGGGGGGG - Intergenic
1021572853 7:22083139-22083161 CGCACGGTGGTCACGGGCGGGGG - Intergenic
1023505751 7:40898469-40898491 CTCCGGGAGGTCGGGGGGGGGGG + Intergenic
1028171335 7:87600483-87600505 CTCTCTGAGCCCGCGGGCGGTGG - Intronic
1029462764 7:100705869-100705891 CTGGCGGAGTTCCCGGCCGGCGG - Intergenic
1032344309 7:131105791-131105813 CCCGCGGAGGGCGCGCGAGGGGG - Intergenic
1034659866 7:152759799-152759821 CGCGCGGGGCTAGCGGGCGGCGG + Exonic
1034911711 7:155003092-155003114 CTCGGCGCGGGCGCGGGCGGGGG - Intergenic
1038828453 8:31032874-31032896 GGCGTGGGGGTCGCGGGCGGCGG - Exonic
1039947119 8:42139960-42139982 CTCGCTGAGGTCTGGGGCGAGGG - Intergenic
1041739073 8:61139546-61139568 CGAGCGGAGGCCGGGGGCGGGGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043502948 8:80874269-80874291 GGCGCGGCGGCCGCGGGCGGGGG + Intronic
1047262394 8:123274474-123274496 CGCGCGGAGGACGCGCGCGCGGG - Exonic
1048886537 8:138914115-138914137 CTCGGGGCGGGAGCGGGCGGGGG + Intergenic
1052192869 9:25678417-25678439 GGAGAGGAGGTCGCGGGCGGCGG + Exonic
1059102447 9:111483685-111483707 GACGCGGAGGACGCAGGCGGCGG - Intronic
1060551397 9:124487087-124487109 CTCGCGGAGGTGGAGGTCGGAGG + Intronic
1061449437 9:130660463-130660485 CGCGCGGAGCTCCCGGGAGGGGG + Intergenic
1062038722 9:134394540-134394562 CTCGCGGAGGTCTCTGGGGGAGG + Intronic
1187419539 X:19122521-19122543 GGCGCCGAGGCCGCGGGCGGGGG - Exonic
1189821323 X:44872776-44872798 CCCGCGGCGGGCGCGAGCGGCGG - Intergenic
1196170940 X:112587859-112587881 CTGGTGGAGGTGGCTGGCGGGGG - Intergenic
1199772740 X:150984405-150984427 CGCGCGGCCGGCGCGGGCGGCGG - Intronic
1200203043 X:154295686-154295708 CTTGCGGAGGGAGCGGCCGGCGG + Exonic