ID: 1151223769

View in Genome Browser
Species Human (GRCh38)
Location 17:72633327-72633349
Sequence TTTAATAACAAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151223761_1151223769 0 Left 1151223761 17:72633304-72633326 CCACCGCATCCAGCCTGTTTGTT No data
Right 1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG No data
1151223763_1151223769 -9 Left 1151223763 17:72633313-72633335 CCAGCCTGTTTGTTTTTAATAAC No data
Right 1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG No data
1151223762_1151223769 -3 Left 1151223762 17:72633307-72633329 CCGCATCCAGCCTGTTTGTTTTT No data
Right 1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG No data
1151223760_1151223769 27 Left 1151223760 17:72633277-72633299 CCAAAGTGCTGAGATTACAGCTG 0: 56
1: 5933
2: 89893
3: 225982
4: 259034
Right 1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG No data
1151223759_1151223769 28 Left 1151223759 17:72633276-72633298 CCCAAAGTGCTGAGATTACAGCT 0: 58
1: 6453
2: 102229
3: 330393
4: 235869
Right 1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151223769 Original CRISPR TTTAATAACAAGGAGGAGGA GGG Intergenic
No off target data available for this crispr