ID: 1151225469

View in Genome Browser
Species Human (GRCh38)
Location 17:72644758-72644780
Sequence TACCATCATGCATATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151225458_1151225469 17 Left 1151225458 17:72644718-72644740 CCTCCTCCTCCTCCAGCGGTGGG No data
Right 1151225469 17:72644758-72644780 TACCATCATGCATATGGGCAGGG No data
1151225463_1151225469 8 Left 1151225463 17:72644727-72644749 CCTCCAGCGGTGGGAGTTAAGGG No data
Right 1151225469 17:72644758-72644780 TACCATCATGCATATGGGCAGGG No data
1151225461_1151225469 11 Left 1151225461 17:72644724-72644746 CCTCCTCCAGCGGTGGGAGTTAA No data
Right 1151225469 17:72644758-72644780 TACCATCATGCATATGGGCAGGG No data
1151225454_1151225469 23 Left 1151225454 17:72644712-72644734 CCGCCTCCTCCTCCTCCTCCAGC 0: 10
1: 151
2: 2964
3: 8580
4: 18784
Right 1151225469 17:72644758-72644780 TACCATCATGCATATGGGCAGGG No data
1151225456_1151225469 20 Left 1151225456 17:72644715-72644737 CCTCCTCCTCCTCCTCCAGCGGT No data
Right 1151225469 17:72644758-72644780 TACCATCATGCATATGGGCAGGG No data
1151225465_1151225469 5 Left 1151225465 17:72644730-72644752 CCAGCGGTGGGAGTTAAGGGAAG No data
Right 1151225469 17:72644758-72644780 TACCATCATGCATATGGGCAGGG No data
1151225460_1151225469 14 Left 1151225460 17:72644721-72644743 CCTCCTCCTCCAGCGGTGGGAGT No data
Right 1151225469 17:72644758-72644780 TACCATCATGCATATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151225469 Original CRISPR TACCATCATGCATATGGGCA GGG Intergenic
No off target data available for this crispr