ID: 1151226383

View in Genome Browser
Species Human (GRCh38)
Location 17:72651255-72651277
Sequence GCAACAGCGTTGAGAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151226375_1151226383 19 Left 1151226375 17:72651213-72651235 CCCCTCAGCATCTACCCATCAGC 0: 1
1: 0
2: 0
3: 9
4: 223
Right 1151226383 17:72651255-72651277 GCAACAGCGTTGAGAGCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 95
1151226379_1151226383 4 Left 1151226379 17:72651228-72651250 CCATCAGCTTAAAATCTGCCCCT 0: 1
1: 0
2: 0
3: 26
4: 870
Right 1151226383 17:72651255-72651277 GCAACAGCGTTGAGAGCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 95
1151226376_1151226383 18 Left 1151226376 17:72651214-72651236 CCCTCAGCATCTACCCATCAGCT 0: 1
1: 0
2: 0
3: 12
4: 217
Right 1151226383 17:72651255-72651277 GCAACAGCGTTGAGAGCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 95
1151226378_1151226383 5 Left 1151226378 17:72651227-72651249 CCCATCAGCTTAAAATCTGCCCC 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1151226383 17:72651255-72651277 GCAACAGCGTTGAGAGCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 95
1151226377_1151226383 17 Left 1151226377 17:72651215-72651237 CCTCAGCATCTACCCATCAGCTT 0: 1
1: 0
2: 2
3: 29
4: 259
Right 1151226383 17:72651255-72651277 GCAACAGCGTTGAGAGCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151226383 Original CRISPR GCAACAGCGTTGAGAGCCAC TGG Intronic
900915495 1:5635381-5635403 TCAACTGGTTTGAGAGCCACAGG - Intergenic
904056446 1:27673696-27673718 GAAACAGAGTTGGGCGCCACAGG + Intergenic
904115580 1:28159359-28159381 GCAACAGTGTGAAAAGCCACAGG + Intronic
908228098 1:62076353-62076375 GAAACAGGGTTGAAAACCACAGG + Intronic
916678769 1:167085992-167086014 CAACCAGGGTTGAGAGCCACTGG + Intronic
1065829477 10:29601567-29601589 GCATCAGAGCTGAAAGCCACAGG - Intronic
1070459525 10:76650346-76650368 GAAAGGGAGTTGAGAGCCACAGG - Intergenic
1072880982 10:99229293-99229315 GGAACAGAGTTGAGAACCAAAGG - Intronic
1073306344 10:102505645-102505667 CCAACAGCGTGGAGAGCCTGGGG + Intronic
1075818387 10:125284159-125284181 ACTACAGCATTGAGAGCGACAGG - Intergenic
1077554592 11:3219780-3219802 GCGTCAGCGGTGAGAGACACGGG + Intergenic
1080141245 11:28922875-28922897 TCAAGAGGCTTGAGAGCCACAGG + Intergenic
1090176759 11:124656849-124656871 GCCACAGCAGTGAGAGGCACAGG + Intronic
1090288386 11:125520053-125520075 GCAATTGGGTTGAGGGCCACAGG - Intergenic
1096185635 12:49578777-49578799 GCTACAGCTGTGAGAGCAACTGG + Intronic
1099758988 12:86893730-86893752 ACAATGGGGTTGAGAGCCACAGG - Intergenic
1101910491 12:108857416-108857438 GCAACAGCGAGGTGAGCCCCGGG - Exonic
1102178214 12:110891985-110892007 GGACCAGCTTTGAGAACCACTGG - Intronic
1111822823 13:93234136-93234158 GCAACAGGGTAGACAGCCTCAGG - Intronic
1121807487 14:96842777-96842799 GCATCAAGATTGAGAGCCACTGG + Intronic
1123113551 14:105883795-105883817 ACAGCAGCCTTGAGAGCCCCAGG + Intergenic
1123117808 14:105902541-105902563 ACAGCAGCCTTGAGAGCCCCAGG + Intergenic
1123120021 14:105912149-105912171 ACAGCAGCCTTGAGAGCCCCAGG + Intergenic
1124389412 15:29240412-29240434 GCAACAGCGTTGGGAGGCGGGGG + Intronic
1124635429 15:31361790-31361812 GCACCAGCCTTGACAGTCACAGG - Intronic
1128398991 15:67257450-67257472 ACAACACCTTTGAGAACCACTGG - Intronic
1132576337 16:666088-666110 GCAACAGTGGTCAGCGCCACCGG - Exonic
1133109225 16:3535825-3535847 GCATCTGCGCTGAGGGCCACTGG - Intronic
1136093459 16:27937126-27937148 GCTGGAGCCTTGAGAGCCACAGG - Intronic
1136093694 16:27938498-27938520 GCTGGAGCCTTGAGAGCCACAGG + Intronic
1138269188 16:55682665-55682687 GCAACTGAGTCAAGAGCCACAGG + Intronic
1139697077 16:68682598-68682620 AGAACAGTGTTGGGAGCCACTGG - Intronic
1145386868 17:22420458-22420480 GAAACAGCGTTGATCGGCACTGG - Intergenic
1150453370 17:65287875-65287897 CCAAGAGCTTTGAAAGCCACTGG - Intergenic
1151226383 17:72651255-72651277 GCAACAGCGTTGAGAGCCACTGG + Intronic
1151227071 17:72655516-72655538 GCGAGGGCGTTGAGAGCCACTGG + Intronic
1155279678 18:24226732-24226754 GGTCCAGCGTTGAGAGCCAAAGG - Intronic
1160541786 18:79627924-79627946 CCAACAGCCTGGAGAGCAACTGG + Intergenic
1161011445 19:1961224-1961246 TCCACAGCCATGAGAGCCACGGG - Intronic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1162498117 19:11034795-11034817 GCAGCAGCGTGGAGCCCCACGGG + Intronic
925212440 2:2061483-2061505 GCAACAACCTTGAGAACCCCAGG + Intronic
929670231 2:43871634-43871656 GCAAGAGCCTTCAGAGCCAAGGG - Intronic
931190786 2:59998213-59998235 GCACCAGCATTGTGAGCCTCAGG - Intergenic
932278926 2:70472746-70472768 GGAAGAGAGTTAAGAGCCACAGG - Intronic
933796944 2:85927378-85927400 GCAACAGCCCTGAGGGCCAGGGG - Intergenic
934538201 2:95154187-95154209 GCAAAAGCCTTCAGAGCCAGTGG + Intronic
938082486 2:128377631-128377653 GCATCATGGTTCAGAGCCACGGG - Intergenic
944425677 2:199580190-199580212 GCAGCGGGGTTCAGAGCCACGGG - Intergenic
946695660 2:222356048-222356070 GCAGCAGACTTGAGAGCCACAGG - Intergenic
1171391339 20:24803436-24803458 GCAACACCAGTGAGAGCCACTGG + Intergenic
1173466247 20:43283987-43284009 GCAAAAGAGATGGGAGCCACAGG - Intergenic
1175798388 20:61786375-61786397 GACACAGCGCTGAGACCCACGGG + Intronic
1175844582 20:62051752-62051774 GGGGCAGCGTTGAGGGCCACAGG - Intronic
1177881307 21:26698357-26698379 GCAGGAGAGTTGAGTGCCACAGG - Intergenic
1177920243 21:27143477-27143499 GCAACATCGTTGCGACACACCGG + Intergenic
1181469882 22:23131748-23131770 GCCCCAGGGTTGAGAGCCCCTGG - Intronic
1182360549 22:29744115-29744137 CCACCAGAGTTGGGAGCCACGGG - Intronic
1183811855 22:40264556-40264578 GCAACTGGGTTGAGAGAAACTGG + Intronic
954249541 3:49357518-49357540 GCAACATCGTTGCGACACACCGG + Exonic
954305754 3:49724425-49724447 GCAACTGCGGCGGGAGCCACCGG + Exonic
955132759 3:56187278-56187300 GCAACAGCACTCACAGCCACTGG + Intronic
956603963 3:71053047-71053069 ACTACAGCGTTGGGAGTCACTGG - Intronic
957403961 3:79753164-79753186 GCAGCAAAGTTGAGAACCACAGG - Intronic
964395327 3:156239570-156239592 GCCCCAGCGCTGAAAGCCACAGG - Intronic
964433504 3:156629192-156629214 CCACCAGGGTTGAGAGCCATTGG + Intergenic
977616140 4:99089084-99089106 GCAACAGCTTTGTGCTCCACTGG + Intergenic
986367371 5:7046201-7046223 GCCACAACGTTGATGGCCACAGG - Intergenic
997933464 5:138090700-138090722 GGAACAGCGCCGAGGGCCACTGG + Exonic
999260792 5:150237620-150237642 GCCACATCCTTGTGAGCCACGGG + Intronic
1002302382 5:178264580-178264602 ACAAGAGGGTTGGGAGCCACTGG - Intronic
1002346491 5:178551614-178551636 GGAACAGCTGTGAGAGGCACTGG - Intronic
1004567904 6:16816453-16816475 GAAAAAGCGTTGAGAAGCACTGG + Intergenic
1006402077 6:33823675-33823697 GGACCAGCTTTGAGAACCACTGG - Intergenic
1015876508 6:137828194-137828216 GCAGCAGAGTTGAGAACCACTGG - Intergenic
1019216042 6:170444540-170444562 GCTACAGCGCTGAGTCCCACAGG + Intergenic
1022774222 7:33508353-33508375 GCAACAGAGTTCAAAGCAACAGG - Intronic
1023254251 7:38297393-38297415 TCACCAGCGTTGAGAGGCAGTGG + Intergenic
1026651099 7:72216574-72216596 ACAAGAGCTTAGAGAGCCACTGG - Intronic
1028229961 7:88295387-88295409 GCACCAGGGTTGAGAACCACTGG - Intronic
1032220940 7:129993711-129993733 GAAATAGCTTTGAGAGCCCCTGG - Intergenic
1034155681 7:148954605-148954627 GCAGCCGCGGTGAGGGCCACAGG - Intergenic
1034574908 7:151988251-151988273 CCAGCAGCGTTGACAGCCAATGG - Intronic
1036209249 8:6828702-6828724 GCAACAGAGTTGGGAGGGACGGG - Intronic
1037541939 8:19880528-19880550 GTAACAGTGCTGAGAGCCAGAGG - Intergenic
1038250390 8:25898656-25898678 GCAAAAGTTTTGAGAGCCACAGG + Intronic
1040849942 8:51889513-51889535 TCAACAGTGTTGAGGGACACAGG - Intronic
1047089588 8:121558830-121558852 GGAACAGCATTGAGCTCCACAGG + Intergenic
1047199058 8:122748571-122748593 GACCCAGGGTTGAGAGCCACTGG + Intergenic
1049679773 8:143912977-143912999 GCACCAGCCATGAGAGCCAGAGG + Intergenic
1053266181 9:36715082-36715104 CCAACTGTGTTGAGAACCACTGG - Intergenic
1185787766 X:2905140-2905162 GCAACAGCACTGAGAGTCATAGG - Exonic
1186829764 X:13378865-13378887 GCAACATCGTTGCGACACACCGG + Intergenic
1189723892 X:43949525-43949547 CAAACAGCATTGAGAGCCAAGGG + Exonic
1190639122 X:52465901-52465923 GCAACAGCGGTAACAGCAACGGG + Intergenic
1190687764 X:52889612-52889634 GCGACTGCTTTGAGAGTCACAGG + Intergenic
1190698218 X:52966180-52966202 GCGACTGCTTTGAGAGTCACAGG - Intronic
1194161388 X:90457391-90457413 GCCAAAGGCTTGAGAGCCACTGG + Intergenic
1200125920 X:153814831-153814853 TCAACAGGGTTGACTGCCACGGG - Intronic
1200507679 Y:4035120-4035142 GCCAAAGGCTTGAGAGCCACTGG + Intergenic
1202388074 Y:24343855-24343877 GCACCAGCTCTAAGAGCCACTGG - Intergenic
1202482713 Y:25326273-25326295 GCACCAGCTCTAAGAGCCACTGG + Intergenic