ID: 1151226591

View in Genome Browser
Species Human (GRCh38)
Location 17:72652539-72652561
Sequence ACTCACCCTCACCCCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151226591_1151226595 17 Left 1151226591 17:72652539-72652561 CCTGTCCTGGGGTGAGGGTGAGT 0: 1
1: 0
2: 1
3: 33
4: 350
Right 1151226595 17:72652579-72652601 AGCGTGAAATAACAGAGACAGGG 0: 1
1: 0
2: 2
3: 12
4: 209
1151226591_1151226593 -10 Left 1151226591 17:72652539-72652561 CCTGTCCTGGGGTGAGGGTGAGT 0: 1
1: 0
2: 1
3: 33
4: 350
Right 1151226593 17:72652552-72652574 GAGGGTGAGTGTTATCACTGAGG 0: 1
1: 0
2: 0
3: 7
4: 160
1151226591_1151226594 16 Left 1151226591 17:72652539-72652561 CCTGTCCTGGGGTGAGGGTGAGT 0: 1
1: 0
2: 1
3: 33
4: 350
Right 1151226594 17:72652578-72652600 CAGCGTGAAATAACAGAGACAGG 0: 1
1: 0
2: 2
3: 45
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151226591 Original CRISPR ACTCACCCTCACCCCAGGAC AGG (reversed) Intronic
901667810 1:10836243-10836265 CCTCACCCTCAGCCCAGCCCTGG - Intergenic
901772211 1:11536232-11536254 ACGCACCCCCACCCCACGCCAGG - Intronic
902044854 1:13516572-13516594 ACTCACCCCCTCTCCAGGAAGGG + Intergenic
902531457 1:17093483-17093505 CCTCACCCTCAGCCCAGCCCAGG + Intronic
902617736 1:17632989-17633011 CCTCACCCTCACCCCACACCAGG - Intronic
902987799 1:20166026-20166048 CCTCACCACCACCCCAGGAATGG - Intronic
903181471 1:21607086-21607108 CCTCACCCTCAACCCAGGACAGG - Intronic
903661561 1:24981769-24981791 ACTCACCCTCACGTGACGACCGG + Intergenic
903882749 1:26522907-26522929 ACAGACCCTCTCCCCAGGACAGG + Intergenic
904286608 1:29456786-29456808 CCTTATCCTCTCCCCAGGACAGG - Intergenic
904302123 1:29561234-29561256 GCTCAGCTTCACCCCAGGGCTGG + Intergenic
904455166 1:30643057-30643079 GCTCAGCTTCACCCCAGGGCTGG - Intergenic
906607598 1:47182719-47182741 CCTGACTCCCACCCCAGGACTGG + Intergenic
909176768 1:72371297-72371319 ACTCAACCTAACCCCACCACTGG - Intergenic
910319385 1:85926660-85926682 CCTGCCCCTCACCCCATGACAGG - Intronic
910892059 1:92028837-92028859 CCTCCCCCTCACCCCAAGACAGG + Intergenic
911999421 1:104812266-104812288 ACTTACCCCCACTCCAGCACAGG + Intergenic
913465093 1:119132381-119132403 TCTGACTCTCTCCCCAGGACTGG + Intronic
914981230 1:152416060-152416082 CCCCACCTTCACCCCAGGACTGG - Intergenic
915810961 1:158910024-158910046 ACTCTCCCTCTTCCCAGGACAGG - Intergenic
916942004 1:169686367-169686389 AATCTCCCCAACCCCAGGACTGG + Intronic
917452837 1:175161536-175161558 ACACACACTCCCCACAGGACAGG + Intronic
919161577 1:193837162-193837184 ACTCCCCGCCACCCCACGACAGG - Intergenic
919228395 1:194739114-194739136 ACTCCCCACCACCCCACGACAGG + Intergenic
919933643 1:202237239-202237261 ATCCAGCCTCACCCCTGGACAGG + Intronic
920231005 1:204469500-204469522 ACTCACTCTCCCCACAGGAAGGG - Exonic
920972976 1:210758340-210758362 ACTCTCTCTCATCGCAGGACAGG + Intronic
921171891 1:212558223-212558245 CCCCACCCCCACCCAAGGACAGG + Intergenic
921186234 1:212671894-212671916 ACCCACCCGCACCCCCGCACAGG + Intergenic
922749750 1:228064856-228064878 CCTCACCCCCACCCCATGTCGGG - Intergenic
923240700 1:232082696-232082718 CCCTACCCCCACCCCAGGACAGG - Intergenic
923418697 1:233790945-233790967 CCCCACCCCCACCCCAGGAAAGG + Intergenic
1062820585 10:531683-531705 ATTTCCCCACACCCCAGGACAGG - Intronic
1063872994 10:10439776-10439798 CCTCTCCCCCGCCCCAGGACAGG - Intergenic
1069045326 10:63737180-63737202 ACTCACACACACCCCAGGAAGGG - Intergenic
1069053614 10:63820552-63820574 ACTCTCCCCTTCCCCAGGACTGG + Intergenic
1070326180 10:75390706-75390728 ACTCCCCCGCACCCCACGAGTGG - Intergenic
1070801531 10:79247009-79247031 GCTAACCCTCACCTCAGGGCTGG - Intronic
1072373970 10:94795151-94795173 CCCCACCCCCACCCCACGACAGG + Intronic
1073500935 10:103936360-103936382 ACACAGCCTCTCCCCAGGACAGG + Intergenic
1074241414 10:111643071-111643093 CCTCCCCCCCACCCCACGACAGG - Intergenic
1074423034 10:113326330-113326352 ACTCATCCTCCCCCCGGGACTGG + Intergenic
1074859257 10:117497899-117497921 GCTCACCCTCACCCCTGGAGGGG + Intergenic
1075591160 10:123692599-123692621 ACCCACCCTCTCCCCAGGTCCGG - Exonic
1075790018 10:125077510-125077532 ACTCACCCCCTCACCAGGCCTGG + Intronic
1075943551 10:126411561-126411583 ACTCACTCTGACCCCCAGACTGG + Intergenic
1076398865 10:130164089-130164111 ACTCAGCCTAACCCCTGCACAGG + Intronic
1076415805 10:130287605-130287627 ACACACACTCACTCCAAGACAGG - Intergenic
1076853154 10:133102954-133102976 ACTGACCCTCCCCCATGGACCGG - Intronic
1077467223 11:2739099-2739121 ACTCAAGGCCACCCCAGGACAGG - Intronic
1078558601 11:12351646-12351668 CCTCACTCTCACCCCAGGGGAGG - Intronic
1079093856 11:17498475-17498497 ACACCCCCTCACCCCAGCTCAGG + Intronic
1080754047 11:35178477-35178499 GCTTAGCCTCAGCCCAGGACAGG + Intronic
1082786338 11:57319240-57319262 ACGCAGCCCCACCCCAGGACTGG + Intronic
1083143369 11:60739606-60739628 ATACACCCTCACTCCAGGACAGG - Intronic
1083272630 11:61580096-61580118 GCCCTCCCCCACCCCAGGACGGG + Intronic
1084401798 11:68948398-68948420 ACTCACCCTCCACTCAGTACGGG + Intergenic
1084535013 11:69751393-69751415 AATCACCCACAGCCCAGGCCGGG + Intergenic
1085820605 11:79789369-79789391 CCTTACCCCCACCCCATGACAGG + Intergenic
1089576507 11:119448063-119448085 ACCCACCTTCACCCCAGGTAGGG - Intergenic
1089670820 11:120055908-120055930 CCTCACTCCCACCCCAGGAAGGG + Intergenic
1089730223 11:120514581-120514603 TTTCACCCCCACCCCAGGCCTGG + Intronic
1090385727 11:126356539-126356561 ACAGAGCCTCCCCCCAGGACTGG - Intronic
1090429358 11:126633219-126633241 CCTCACCCCCACCCCACAACAGG - Intronic
1091242706 11:134064589-134064611 TCTCACCTTCTCCCCAGGCCAGG + Intergenic
1091332163 11:134738132-134738154 CTGCACCCTCACCCCAGGCCTGG + Intergenic
1091346823 11:134859770-134859792 TCTCAGCCTTACCCCAGGGCAGG - Intergenic
1091898287 12:4122226-4122248 AATCACCCAGACACCAGGACAGG - Intergenic
1092306360 12:7304990-7305012 ACTGATCCTCACCCCATGCCAGG + Intronic
1094253991 12:28400350-28400372 CCCCACCCCCACCCTAGGACTGG + Intronic
1096518570 12:52171613-52171635 CCTCACCCTCACCCCACCATGGG + Intronic
1096994323 12:55829523-55829545 GCTCACCCTGGCCCCAGGCCGGG - Exonic
1097143723 12:56925313-56925335 CTGCATCCTCACCCCAGGACAGG + Intronic
1097526028 12:60737362-60737384 CCTGACCCCCACCCCATGACAGG - Intergenic
1098839449 12:75461286-75461308 CCTTCCCCTGACCCCAGGACAGG + Intergenic
1099093284 12:78340153-78340175 CCTCACCCTCACCCCCCAACCGG - Intergenic
1100544893 12:95592243-95592265 ACTAACCCTCTCCCCAGAAGAGG - Intergenic
1101490847 12:105208122-105208144 ACACACCCACACACCAGGAATGG + Intronic
1102052368 12:109872069-109872091 AATCACCACCATCCCAGGACCGG + Intronic
1104751381 12:131241889-131241911 ACACACCCTTTCCCCAGTACAGG + Intergenic
1104912798 12:132247760-132247782 ACTCGCCCTCACCCCATCCCCGG + Intronic
1107382676 13:39874486-39874508 ACTCATCCAAACCCCAGTACTGG - Intergenic
1107412749 13:40172691-40172713 ACTCACACTCATCCCAGCCCAGG + Intergenic
1113727525 13:112616253-112616275 ACTCACAGTCACCCCAGCTCCGG + Intergenic
1114493016 14:23114886-23114908 TCTCACCCCCACCCCATGAGAGG + Intergenic
1116650034 14:47578246-47578268 CCTCACCCCCACCCCCTGACTGG - Intronic
1117548610 14:56812240-56812262 ACTCACCCTCCCCCCCGCCCGGG - Intergenic
1118726831 14:68634674-68634696 TCTCACCCCCACCCCATTACTGG - Intronic
1119725220 14:76918235-76918257 CCTCACCCTCACCCCAGCCAAGG + Intergenic
1120067171 14:80056242-80056264 ACACACACACACCCCAGGCCTGG - Intergenic
1121215719 14:92246209-92246231 ACTCACCCCCACCCAGGGAAGGG + Intergenic
1123397738 15:19954196-19954218 ACACCCCCTCACCCCACAACAGG - Intergenic
1124378303 15:29142510-29142532 TCTCCGCCTCACCCCAGCACTGG - Intronic
1125238189 15:37540639-37540661 ACTTCCCCCCACCCCAGGAATGG - Intergenic
1126660846 15:51031530-51031552 CCTCTCCCTCCCCCCAGCACTGG - Intergenic
1126760376 15:51964393-51964415 CCTGCCCCTCACCCCATGACAGG - Intronic
1127150163 15:56066283-56066305 GCTCTCCCCCACCCCATGACAGG + Intergenic
1127795672 15:62436385-62436407 CCTCTGCCTCACCCCAGGCCAGG - Intronic
1129579033 15:76785869-76785891 ACAGTCCCTCACCCCACGACAGG - Intronic
1129998459 15:80026815-80026837 ACTGACCCACACCCCACGCCCGG - Intergenic
1130561567 15:84963318-84963340 ATACACCCTCTCCCCAGGAGTGG + Intergenic
1130684340 15:86023798-86023820 TCTCACCCTCATCCCAAGACAGG - Intergenic
1130878039 15:88031434-88031456 GATCAGGCTCACCCCAGGACTGG - Intronic
1131498070 15:92932441-92932463 CCTCCCCCCCACCCCATGACAGG + Intronic
1132416090 15:101619924-101619946 ACTCACTCTGACCCCCAGACTGG + Intergenic
1132760798 16:1507700-1507722 ACTCACCCGCCAGCCAGGACCGG - Exonic
1132824095 16:1894390-1894412 AGACACCCACACTCCAGGACAGG - Intergenic
1132939466 16:2499698-2499720 TCCCACCCCCACCCCAGGGCAGG - Intronic
1133659248 16:7899795-7899817 ACTCACCCTCACCCTATTACTGG - Intergenic
1134217315 16:12326344-12326366 ACTGCCCCTCACACCTGGACAGG - Intronic
1136286226 16:29244455-29244477 CCTAACCCTCACCCCCCGACAGG + Intergenic
1136747728 16:32606716-32606738 ACTCACACTGGCTCCAGGACTGG - Intergenic
1137449594 16:48558736-48558758 AGTCACCCACACCCCAAGCCCGG - Intronic
1138434257 16:56988618-56988640 ACCCACACCCACCCCAGGCCTGG + Intergenic
1139370742 16:66467945-66467967 AATCACACTCAACCTAGGACAGG - Intronic
1139625000 16:68180648-68180670 ACTTTCCCCCACCCCACGACAGG + Intronic
1140414028 16:74760481-74760503 ACACTCCCTCACCCCATGAAAGG + Intronic
1142091567 16:88214651-88214673 TCTAACCCTCACCCCCCGACAGG + Intergenic
1142149081 16:88504873-88504895 AGACACCCCCTCCCCAGGACAGG + Intronic
1142194630 16:88733745-88733767 ACTGACCCTCACACCATCACAGG - Exonic
1142199267 16:88753348-88753370 ACACCCACTCACCCAAGGACGGG + Intronic
1142266881 16:89068040-89068062 AGACACCCTCTCCCCAGGGCTGG + Intergenic
1203049863 16_KI270728v1_random:865925-865947 ACTCACACTGGCTCCAGGACTGG - Intergenic
1142591645 17:1008770-1008792 ACCCACCTGCACGCCAGGACCGG - Intronic
1145207305 17:20991419-20991441 GCTCACGCTCACCCCATGTCTGG - Intergenic
1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG + Exonic
1146056640 17:29584670-29584692 CCCCACCCCCACCCCAGGACAGG - Intronic
1146063186 17:29617614-29617636 TCTCCCCCTCCCCCCAGGAGAGG - Exonic
1147531411 17:41281599-41281621 CCTGACCCCCACCCCATGACAGG - Intergenic
1147976186 17:44249521-44249543 CCCCACCCCCACCCCAGGGCAGG + Exonic
1148738679 17:49879825-49879847 CCTCACCCTCGCCCCAGGTTAGG - Intergenic
1148885006 17:50766112-50766134 ACTCAGCCCCTTCCCAGGACAGG + Intergenic
1148902022 17:50885387-50885409 CCTCAGCCTCACCTCAGGCCAGG - Intergenic
1148969598 17:51468268-51468290 TCTCACTCTCTCCCCAGGATGGG + Intergenic
1150249737 17:63699194-63699216 TCTCCCCTTCACCCCAGGCCAGG + Intronic
1151226591 17:72652539-72652561 ACTCACCCTCACCCCAGGACAGG - Intronic
1151376775 17:73694629-73694651 ACCCACTCCCTCCCCAGGACAGG - Intergenic
1151794475 17:76334174-76334196 CCCCACCCCCACCCCAAGACGGG - Intronic
1152206665 17:78977911-78977933 ACTGACACTCAGGCCAGGACTGG + Intronic
1152252314 17:79218521-79218543 ACTCCCCCTCTCCCCAGCAGGGG - Intronic
1153108886 18:1560370-1560392 AGGCTCCCTCACCCCAGGTCGGG - Intergenic
1153177939 18:2399969-2399991 CCTCTCCCCCACCCCATGACAGG - Intergenic
1155429247 18:25738241-25738263 ACTCACCCTCACACAGGGTCAGG + Intergenic
1156380444 18:36554479-36554501 CCCCACCCCCACCCCACGACAGG - Intronic
1156709093 18:39920111-39920133 CCTCACCCCAACCCCATGACAGG + Intergenic
1157488982 18:48109096-48109118 CCCCACCCTCACCCCACAACTGG - Intronic
1158781950 18:60662768-60662790 CCTCACCACCACCCCAGGTCTGG - Intergenic
1159502441 18:69291255-69291277 CCTCACCCTAGCCCCAAGACAGG + Intergenic
1160186253 18:76678841-76678863 CCTCATCCTCAGCCCAGGACAGG + Intergenic
1160275778 18:77433663-77433685 CCTCCCCCTCACCCCACGTCAGG + Intergenic
1160430984 18:78812404-78812426 ACACCCCCACACCCCAGGAAAGG + Intergenic
1160534951 18:79586782-79586804 ACTTAACCTCACCTGAGGACTGG - Intergenic
1160827728 19:1088562-1088584 AGGAAGCCTCACCCCAGGACGGG + Exonic
1160858749 19:1228827-1228849 ACTCGCCCTCAGTCCCGGACGGG - Exonic
1161630933 19:5355081-5355103 ACACACCCCCACCCCCAGACCGG + Intergenic
1161873340 19:6887629-6887651 CCTCACACTCACCCCAGAAGAGG - Exonic
1162101605 19:8342595-8342617 AGGCGCCCTCTCCCCAGGACTGG - Intronic
1162927075 19:13936080-13936102 ACTCCCCCTCCACCCAAGACAGG - Intronic
1163068658 19:14819318-14819340 CCTCACCCCCACCCCCTGACAGG + Intronic
1163692955 19:18746979-18747001 ACACACTCTCAGCCCAGGGCAGG - Intronic
1164675116 19:30095539-30095561 AGTCCCCTTCACCCCAGGGCTGG - Intergenic
1164986118 19:32650001-32650023 AATCAGCCTCACCCCACCACAGG + Intronic
1165075730 19:33278980-33279002 ACTGACCCCCAGCCCAGGGCAGG + Intergenic
1165862999 19:38918813-38918835 ACTCATCCTCTCCCCTGAACAGG - Exonic
1166354063 19:42216959-42216981 ACTCATCCTCCTCCCAGCACGGG + Exonic
1168351929 19:55680867-55680889 ACTCGCCCTCATGCCAGAACAGG - Intronic
927282710 2:21324517-21324539 ACTCCCCGCCACCCCACGACAGG + Intergenic
928316831 2:30252884-30252906 TCTCACCCTCAGCCCAGGGTAGG - Intronic
928534853 2:32230086-32230108 CCTCACCCTCACTCCAGTTCAGG - Intronic
929953145 2:46432450-46432472 ACTCACCCTCCCCCCAGGTTGGG - Intronic
931195986 2:60052679-60052701 ATCCACCCTCACCCCATGAGTGG - Intergenic
931885203 2:66609792-66609814 CCTGCCCCCCACCCCAGGACAGG + Intergenic
937390629 2:121482875-121482897 CCTCAAACTCTCCCCAGGACCGG + Intronic
937546658 2:123030361-123030383 ACTCCCCCCCACCCCACAACAGG - Intergenic
937588981 2:123591231-123591253 ACTCACCATCAGCCCATGAAAGG - Intergenic
937954872 2:127416446-127416468 ACTCCTCCCCACCCCAGCACAGG - Intergenic
938696121 2:133837088-133837110 ACTGAGCCCCACCCCTGGACAGG - Intergenic
939038940 2:137164873-137164895 CCTCTCCCCCACCCCACGACAGG - Intronic
941134352 2:161696061-161696083 ACTTCCCCCCACCCCACGACAGG + Intronic
941735869 2:168976571-168976593 ACTCACCTTCACCTCTGGTCTGG + Exonic
942640428 2:178055340-178055362 CCTCCCCCCCACCCCATGACAGG - Intronic
943150674 2:184108157-184108179 CCCCACCCCCACCCCACGACAGG - Intergenic
943397444 2:187357496-187357518 CCTCACCCCCACCCCCCGACAGG - Intronic
943649905 2:190446151-190446173 ACTAAACCTCACCACAAGACAGG - Intronic
944393704 2:199246207-199246229 CCTCACCCCCACCCCAAGGCTGG + Intergenic
946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG + Intronic
947114501 2:226754269-226754291 ACCCACCCTCACTCCAGGAATGG - Intronic
948872850 2:240812322-240812344 CCTCACCGTCACCCCATGCCTGG - Intronic
1168963281 20:1883276-1883298 ACCCACCCCCACCCCAGGCTAGG + Intergenic
1170529115 20:17271884-17271906 ACTCTACAACACCCCAGGACAGG + Intronic
1171257004 20:23696958-23696980 CCATACCCCCACCCCAGGACAGG - Intergenic
1171264359 20:23758817-23758839 CCACACCCCCACCCCATGACAGG - Intergenic
1171776537 20:29373395-29373417 ACTGACCCTGACCCCAAGAAGGG - Intergenic
1172032607 20:31992439-31992461 GCTCACACGCTCCCCAGGACAGG - Intronic
1172119488 20:32589422-32589444 ACTCTGCCCCACCCCAGGCCTGG - Intronic
1172485111 20:35293165-35293187 TCTCACCCTGACCCCAGGGGTGG + Intergenic
1173445755 20:43116612-43116634 ATGAGCCCTCACCCCAGGACTGG + Intronic
1174377047 20:50133209-50133231 GCTGCCCCTCACCCCAGGCCTGG - Intronic
1175324074 20:58110452-58110474 AATTACCCCCACCCCAGAACTGG - Intergenic
1176273196 20:64247153-64247175 CCTCACCCAGATCCCAGGACTGG + Intergenic
1176734431 21:10531276-10531298 ACTCACCCTCACTCCAAGGGAGG - Intronic
1178616987 21:34143352-34143374 ACTGTCCCTCATCCCAGGGCAGG + Intergenic
1179156653 21:38857175-38857197 ACTGAGCCTCACCCAGGGACAGG + Intergenic
1179482145 21:41685261-41685283 CCTCATCCTAACCCCAGGACCGG - Intergenic
1180087369 21:45514031-45514053 ACTCACCCGTCCACCAGGACAGG - Exonic
1180195541 21:46191494-46191516 ACTCAGCCTCATCCCAGGGGAGG + Intronic
1180535419 22:16390511-16390533 ACTCCCACTCACCCCAGGAAGGG - Intergenic
1180562172 22:16626752-16626774 ACTCACCCTCACTCCAAGGGAGG - Intergenic
1181522072 22:23454707-23454729 ACTCATCCTCAACCCAGCATGGG - Intergenic
1182131413 22:27855605-27855627 CCTCACCCCCACCCCGGAACCGG + Intronic
1182839760 22:33379410-33379432 TCTCTCCCCCACCCCATGACAGG + Intronic
1183133779 22:35866817-35866839 ACTCCCACTCACGCCAGGAAAGG + Intronic
1183257349 22:36771037-36771059 ACACACACACACCCCAAGACAGG - Intronic
1183329359 22:37211285-37211307 ACTCACTGGCACCCCAGGCCTGG + Intronic
1183739709 22:39662887-39662909 TCTAACCCTCACCCCAGGCCTGG - Intronic
1184069273 22:42138100-42138122 TCTCAACCTCACCACAGGACTGG - Intergenic
1184133602 22:42532745-42532767 ACACACCCTCATCCAATGACTGG - Intergenic
1184751510 22:46489033-46489055 ACACACCCACACCCCATGGCAGG + Intronic
951053197 3:18118175-18118197 CGTTACCCCCACCCCAGGACAGG - Intronic
952953752 3:38544026-38544048 ACCCACCCACATCCCAGGCCAGG + Intergenic
953091415 3:39730121-39730143 CCTCACCCCCACCCCACAACAGG + Intergenic
953533038 3:43755382-43755404 ACCCAGCCTCACCCCTGCACAGG - Intergenic
953913734 3:46905428-46905450 CCCCACCCACACCCCAGGACAGG + Intergenic
955895973 3:63700219-63700241 CCTGGCCCCCACCCCAGGACAGG - Intergenic
957088549 3:75706258-75706280 ACTGACCCTGACCCCAAGAAGGG + Intergenic
957341880 3:78910386-78910408 ACTTAGGCTCACCCGAGGACTGG + Intronic
957574881 3:81994724-81994746 ACTCTCCCTTACCCCAGTCCTGG + Intergenic
959108810 3:102097151-102097173 CCTCCCCCTCACCCCAGCCCAGG - Intergenic
960565678 3:119129152-119129174 CCTCACCCCCACCCCACAACAGG - Intronic
961439560 3:126944853-126944875 ACTTACCTTCTCCTCAGGACTGG + Intronic
961527723 3:127517546-127517568 CCTTCCCCTCACCCCATGACAGG - Intergenic
961795879 3:129408578-129408600 CATCACCCTCACCCCAGCTCTGG + Intronic
962282699 3:134064334-134064356 ACTGCCCCCCACCCCAGGAGGGG + Intergenic
962435627 3:135363986-135364008 ACTCACTGTCACCCCAGGATAGG - Intergenic
963420797 3:145058647-145058669 ACTCACCCTTTCCCCAGAAGAGG - Intergenic
964242752 3:154616001-154616023 ACTTACCCTCACCCTAGAGCTGG + Intergenic
965969137 3:174532218-174532240 AGTCCTCCTCACCCAAGGACAGG - Intronic
966478111 3:180373358-180373380 ACTGCCCCCCACCCCATGACAGG - Intergenic
968560709 4:1279970-1279992 CATCCCCCTCACCCCACGACAGG - Intergenic
968899722 4:3425630-3425652 ACTCACCCCCTCCCCTGCACCGG - Intronic
968899960 4:3426291-3426313 ACTCACCCCCTCCCCTGCACTGG - Intronic
969666062 4:8558182-8558204 GCCCACCCTGTCCCCAGGACTGG + Intergenic
970478227 4:16446611-16446633 ACCTCCCCTCACCCCATGACAGG + Intergenic
970884627 4:20973773-20973795 TCTCACCCTCTCCACAGGGCCGG - Intronic
971127923 4:23774779-23774801 ACTCTCCCTCTCCCCATGAAGGG - Intronic
972775571 4:42236771-42236793 ACTAACCCTCACACCTGGTCAGG - Intergenic
972864226 4:43210462-43210484 CCCCACCCCCACCCCACGACAGG - Intergenic
973149865 4:46873818-46873840 CCTTCCCCTCACCCCATGACAGG + Intronic
975522993 4:75320146-75320168 CCTCTCCCCCACCCCACGACAGG - Intergenic
976152953 4:82111058-82111080 ACTCACCCTCAGTCCAGCACAGG - Intergenic
977127260 4:93185894-93185916 CCTGACCCCCACCCCATGACAGG + Intronic
977460999 4:97325157-97325179 CCTCACCCTTACCCCACAACAGG + Intronic
980607201 4:135108811-135108833 ACTCCCCCCCACCCCACAACAGG + Intergenic
981208500 4:142072329-142072351 ACCTCCCCTCACCCCATGACAGG - Intronic
981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG + Intergenic
981986393 4:150862522-150862544 CCTCTCCCCCACCCCATGACAGG - Intronic
982985186 4:162198276-162198298 ACTCACCCTCACCCTACAATGGG - Intergenic
983755590 4:171330558-171330580 ACTCACCCTTTCCCCATGTCAGG - Intergenic
984165053 4:176296355-176296377 ACCCACCCCCGACCCAGGACTGG - Intergenic
991411636 5:66351906-66351928 ACATTCCCTCACCCCAGAACAGG - Intergenic
991455498 5:66799292-66799314 ACCCACCCTCACCCCAATCCAGG + Intronic
992274074 5:75096810-75096832 CCCCACCCCCACCCCATGACAGG + Intronic
995684813 5:114760766-114760788 CCTCACCCCCACCCCACAACAGG + Intergenic
996305793 5:122046194-122046216 ACCCCCCCTCACCCCACAACAGG + Intronic
997471956 5:134122214-134122236 TCCCTCCCTGACCCCAGGACAGG - Intronic
999689381 5:154133775-154133797 ACACACACACACCCCAGCACAGG + Intronic
1000231243 5:159317103-159317125 TCTCACCATCAGCTCAGGACTGG - Intronic
1000423890 5:161068328-161068350 CCTGCCCCCCACCCCAGGACAGG + Intergenic
1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG + Intronic
1001716196 5:173818265-173818287 AGTCACCCTCAGACTAGGACAGG + Intergenic
1002173494 5:177388202-177388224 CCCCACCCTCACCCCATGCCAGG - Intronic
1003516985 6:6825854-6825876 ACTCATTCTCAACCCAGGAACGG + Intergenic
1005222072 6:23598227-23598249 CCCCTCCCCCACCCCAGGACAGG - Intergenic
1006455876 6:34131613-34131635 CCTCACCCCCACCCCAACACTGG + Intronic
1006873719 6:37277081-37277103 ACACACACGCACACCAGGACCGG - Intronic
1007347841 6:41246901-41246923 ACTCCCCCTCACCCCACAGCAGG - Intergenic
1007371363 6:41428453-41428475 CCACACCCCCACCCCAGGGCTGG + Intergenic
1007582768 6:42969098-42969120 AGCCTCCCTGACCCCAGGACAGG + Intronic
1009865443 6:69392380-69392402 CCTTGCCCTCACCCCACGACAGG - Intergenic
1010851151 6:80779952-80779974 ACTCCCCCCCACCCCACAACAGG + Intergenic
1011242411 6:85286942-85286964 CCCCACCCCCACCCCACGACAGG + Intergenic
1011544801 6:88471366-88471388 TCTGCCCCTCACCCCATGACAGG - Intergenic
1012117551 6:95322407-95322429 CCACACCCCCACCCCACGACAGG + Intergenic
1012740385 6:103008861-103008883 CCTTCCCCTCACCCCATGACAGG - Intergenic
1013482383 6:110563695-110563717 TGTCACCCCCACCCCAGGCCTGG + Intergenic
1014358228 6:120438550-120438572 CCTTCCCCTCACCCCATGACAGG - Intergenic
1014968660 6:127788109-127788131 ACTCTCCCTCACCTGAGGAAAGG - Intronic
1014976691 6:127893765-127893787 AGTCATCATCACCACAGGACGGG + Intronic
1016022371 6:139249606-139249628 TCACACCCACACCCCAAGACTGG - Intronic
1016038998 6:139412480-139412502 CCTGCCCCTCACCCCAGGACAGG - Intergenic
1016892219 6:149017927-149017949 AATCACCCTCACCACATGGCTGG + Intronic
1017274835 6:152554050-152554072 GCTGAGCCTCTCCCCAGGACTGG - Intronic
1018529781 6:164750495-164750517 ACACCCCCTCGCCCCAGAACTGG + Intergenic
1018681439 6:166269113-166269135 ACCCACCCTCACCTCATGACAGG - Intergenic
1019589274 7:1821884-1821906 ACTCATCCTCAACCCAGCATGGG + Intronic
1023213971 7:37841019-37841041 ACACTCTCCCACCCCAGGACAGG + Intronic
1023345412 7:39266459-39266481 AATCACCCTCAACCCAGCCCAGG + Intronic
1023615209 7:42012866-42012888 ACTCTCCCTGCCCCCAGGAAAGG + Intronic
1024246827 7:47477135-47477157 ACTTACCGACATCCCAGGACAGG - Intronic
1024477633 7:49830666-49830688 CCACCCCCTCACCCCACGACAGG + Intronic
1024898232 7:54285338-54285360 ACTCCCTGTCACCCCATGACTGG + Intergenic
1025739892 7:64185943-64185965 CCTTACCCCCACCCCACGACAGG + Intronic
1026879190 7:73897892-73897914 GCTCACCTTCTCTCCAGGACCGG + Intergenic
1027144091 7:75681903-75681925 ACCCACCATCTCCCCTGGACTGG + Intronic
1027810413 7:82889286-82889308 CCTCGCCATAACCCCAGGACAGG + Intronic
1029457758 7:100679644-100679666 ACCCACCCCAACCCCAGGAAGGG + Exonic
1029574904 7:101396946-101396968 ACCCAGCGTCACCCCAGGCCTGG - Intronic
1029763313 7:102612154-102612176 GCCCTCCCTCGCCCCAGGACGGG + Intronic
1029953783 7:104615673-104615695 ACCCACCCCCACCCCCTGACAGG + Intronic
1030103486 7:105967102-105967124 CCTTCCCCTCACCCCATGACAGG + Intronic
1030709303 7:112731330-112731352 CCTTCCCCTCACCCCACGACAGG + Intergenic
1031085585 7:117298911-117298933 ACTCCCACTCTCCCCAGGTCGGG + Intronic
1031783086 7:125994768-125994790 ACTGCCCCCCACCCCACGACAGG - Intergenic
1032844628 7:135742002-135742024 CCTCACCCCCACCCCTGCACTGG + Intronic
1034430594 7:151039368-151039390 ACTCACCCCCACCCTAGTGCTGG + Intronic
1035785195 8:2254350-2254372 AATCACGCTCCCTCCAGGACAGG - Intergenic
1035807613 8:2467366-2467388 AATCACGCTCCCTCCAGGACAGG + Intergenic
1037704897 8:21310515-21310537 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705027 8:21311070-21311092 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705106 8:21311377-21311399 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705130 8:21311464-21311486 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705172 8:21311639-21311661 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705204 8:21311771-21311793 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705241 8:21311942-21311964 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705262 8:21312029-21312051 ACTGACTCTCAGCCCTGGACTGG - Intergenic
1037705285 8:21312116-21312138 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705294 8:21312159-21312181 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705599 8:21313363-21313385 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705659 8:21313619-21313641 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037705778 8:21314124-21314146 ACTGACTCTCAGCCCCGGACTGG - Intergenic
1037824903 8:22155309-22155331 ACTCTCCCTCTCCCCAGCCCAGG + Intronic
1038141407 8:24849313-24849335 CCTCCCCCCCACCCCATGACAGG + Intergenic
1039762997 8:40598360-40598382 CCTCACCCCCACCCCCTGACAGG + Intronic
1040541214 8:48357721-48357743 ACTGACCCCCATCCCACGACAGG - Intergenic
1045468358 8:102489489-102489511 ACTCCCCCTCACCCTGGGTCAGG + Intergenic
1045867598 8:106885720-106885742 ACTCCCCCCCACCTCACGACAGG - Intergenic
1045916376 8:107476428-107476450 GCTCCCCCCCACCCCATGACAGG - Intronic
1046006680 8:108494587-108494609 GCTCCCCCACACCCCATGACAGG + Intergenic
1046153909 8:110262784-110262806 ACACACACGCACCCCAGCACAGG - Intergenic
1047321803 8:123793012-123793034 ACTCACCCTCAACCTAAGCCAGG + Intronic
1049203199 8:141351718-141351740 CCCCACCCCCACCCCAGGACAGG - Intergenic
1049213517 8:141397398-141397420 ACCCAACCCCAACCCAGGACAGG - Intronic
1049535902 8:143181629-143181651 TCACAGCCTCACCCCAGGGCAGG + Intergenic
1050220066 9:3377437-3377459 CCTTCCCCTCACCCCATGACAGG - Intronic
1051355940 9:16239893-16239915 GCTCACCCTCACCCCCAGCCAGG + Intronic
1051368257 9:16336517-16336539 GCTCACCCTGTCTCCAGGACTGG + Intergenic
1051736888 9:20209560-20209582 ACTCACCAACACCCCCAGACTGG + Intergenic
1052451002 9:28631306-28631328 CCCCACCCCCACCCCATGACAGG + Intronic
1052642129 9:31181909-31181931 CCCCACCCCCACCCCACGACAGG - Intergenic
1052645098 9:31224896-31224918 CCTTACCCCCACCCCATGACAGG + Intergenic
1053480358 9:38412252-38412274 GCTCACCCTTCCCCCACGACTGG - Intronic
1054938519 9:70714631-70714653 CCTCCCCCCCACCCCACGACAGG - Intronic
1054940210 9:70732624-70732646 CCTCCCCCCCACCCCACGACAGG - Intronic
1055332306 9:75197166-75197188 ACTCACCCTCACCCCCCGTGGGG + Intergenic
1056363961 9:85884567-85884589 CCTCACCCTCACTCCATGAGGGG - Intergenic
1056579896 9:87883157-87883179 ACCCACCCTCACCCCCGCCCGGG + Exonic
1056797224 9:89666822-89666844 ACTTACCCTCACTGCAGGGCTGG + Intergenic
1057301916 9:93891471-93891493 ACCTGCCCTCACCCCAGGGCAGG - Intergenic
1058111574 9:101035968-101035990 CCCCACCCTCACCCCAGCCCTGG - Intronic
1058512192 9:105731454-105731476 CCTCCCTCTCACCCCACGACAGG + Intronic
1058554645 9:106153864-106153886 CCTTCCCCTCACCCCAAGACAGG - Intergenic
1058840519 9:108903224-108903246 ACCCTCCCCCACCCCACGACAGG + Intronic
1059672995 9:116509156-116509178 CCTTCCCCTCACCCCACGACAGG + Intronic
1060441132 9:123640364-123640386 ACCCACCCTTACCCCCTGACTGG - Intronic
1061451073 9:130667196-130667218 CCTCACCCCCAGCCCAGGACTGG - Intronic
1062183395 9:135203148-135203170 ACTCCCTCTCTCCCCAGGGCAGG + Intergenic
1062490150 9:136801074-136801096 AAACACCCTCACCCTAAGACTGG + Intronic
1062544306 9:137054715-137054737 CCTCACCTTCACCTCAGTACAGG - Intergenic
1062671855 9:137715621-137715643 ACACACACTCAGCTCAGGACAGG - Intronic
1186169491 X:6861830-6861852 ACACACCCCCACCCCAGGGAAGG + Intergenic
1187266310 X:17737323-17737345 TCCCGCCCTCACCCAAGGACTGG + Intergenic
1187298465 X:18025561-18025583 ACTCACCCCCACCCCAAACCTGG - Intergenic
1188587580 X:31796789-31796811 ACTCAACCTGCCCCCAGGAAGGG - Intronic
1189255007 X:39631126-39631148 ACTCACCTTCACCCAAGGTCCGG + Intergenic
1189284072 X:39839531-39839553 CCCCACCCTCACCCCGGGGCAGG + Intergenic
1192387494 X:70686529-70686551 CCTCACCCTCACCTCCCGACAGG - Intronic
1192589592 X:72348929-72348951 AATCACCCTCCCCCAAGGAAGGG + Intronic
1194956618 X:100188657-100188679 ACTCTCCCTCAACCCTGGACAGG + Intergenic
1196092981 X:111766699-111766721 CCCCACCCCCACCCCATGACAGG + Intergenic
1196668200 X:118338407-118338429 CCTCCCCCTCACCCCACGACAGG + Intergenic
1197395073 X:125917516-125917538 CCTCACCCTCACCTCCCGACAGG + Intergenic
1200045871 X:153400868-153400890 ACACCCCCTCACCCCAGCACTGG + Intergenic
1200398223 X:156003584-156003606 ACTCACCCTCATCCCTGTCCAGG - Intronic
1201559823 Y:15304118-15304140 ACACACCCCCACCCCAGGGAAGG + Intergenic
1201619661 Y:15942283-15942305 ACTCCCCCGCACCCCATGACAGG + Intergenic