ID: 1151227005

View in Genome Browser
Species Human (GRCh38)
Location 17:72655212-72655234
Sequence GCGTGTGCACGGGTGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 763
Summary {0: 1, 1: 0, 2: 8, 3: 85, 4: 669}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151227005_1151227018 23 Left 1151227005 17:72655212-72655234 CCTCCACACACCCGTGCACACGC 0: 1
1: 0
2: 8
3: 85
4: 669
Right 1151227018 17:72655258-72655280 CCCCGCTGCTTGTTGGGCATTGG 0: 1
1: 0
2: 0
3: 9
4: 94
1151227005_1151227021 30 Left 1151227005 17:72655212-72655234 CCTCCACACACCCGTGCACACGC 0: 1
1: 0
2: 8
3: 85
4: 669
Right 1151227021 17:72655265-72655287 GCTTGTTGGGCATTGGTCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 83
1151227005_1151227015 17 Left 1151227005 17:72655212-72655234 CCTCCACACACCCGTGCACACGC 0: 1
1: 0
2: 8
3: 85
4: 669
Right 1151227015 17:72655252-72655274 CCCTCGCCCCGCTGCTTGTTGGG 0: 1
1: 0
2: 1
3: 2
4: 77
1151227005_1151227013 16 Left 1151227005 17:72655212-72655234 CCTCCACACACCCGTGCACACGC 0: 1
1: 0
2: 8
3: 85
4: 669
Right 1151227013 17:72655251-72655273 TCCCTCGCCCCGCTGCTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151227005 Original CRISPR GCGTGTGCACGGGTGTGTGG AGG (reversed) Intronic
900137410 1:1123930-1123952 GTGTGTGCGCAGGTGTGTGCAGG - Intergenic
900137412 1:1123952-1123974 GTGTGTGCAGGAGTGTGTGCAGG - Intergenic
900137413 1:1123964-1123986 GCATGTGCGCAGGTGTGTGCAGG - Intergenic
900187858 1:1340818-1340840 GTGTGTGCAGGTGTGTGTGCAGG - Intronic
900215585 1:1479875-1479897 GCGTGTGCATGCCCGTGTGGGGG - Intronic
900246266 1:1637553-1637575 CCGGGTGCAGGGGTGGGTGGGGG - Intronic
900257493 1:1704695-1704717 CCGGGTGCAGGGGTGGGTGGGGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900353844 1:2250347-2250369 GCGTGTCCTCGAGTGTGGGGTGG + Intronic
900427476 1:2587114-2587136 GCGGGAGCACGCGTGCGTGGTGG + Exonic
900464635 1:2819543-2819565 GCGTGTGTGCAGTTGTGTGGGGG - Intergenic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
900563694 1:3321663-3321685 GTGGGTGCACGTGTGTGTGTGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900593542 1:3470234-3470256 GTGTATGCATGGGTGTGTGGGGG + Intronic
900593691 1:3470984-3471006 GCGTGGGCAGGGGTGTGCGTGGG + Intronic
901205493 1:7492892-7492914 GTGTGTGCACGTGTGTATGTAGG - Intronic
902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG + Exonic
902272508 1:15314757-15314779 GGGGGTGTATGGGTGTGTGGGGG + Intronic
902272520 1:15314796-15314818 GGGGGTGAATGGGTGTGTGGGGG + Intronic
902568258 1:17330080-17330102 GCGTGTGCACAGTGGCGTGGTGG + Intronic
902690318 1:18107012-18107034 GTGTGTGCTCGCGTGTGTGTTGG + Intergenic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
903474038 1:23607254-23607276 GCGTGGGCAACAGTGTGTGGAGG - Intronic
903986803 1:27234729-27234751 GTGTGAGCGCGGGTGTGAGGCGG + Exonic
904470358 1:30732157-30732179 GTGTTTACATGGGTGTGTGGGGG + Intergenic
904470390 1:30732260-30732282 GTGTGTGGAGGGGTGTGGGGAGG + Intergenic
904541935 1:31239367-31239389 GCGTGTGCCCGGGCGGGGGGTGG - Intronic
904563701 1:31414613-31414635 GCGTGTGCATGTGCGTGTGCAGG + Intronic
904687687 1:32272760-32272782 GTGTGTGTGGGGGTGTGTGGGGG + Intronic
905016850 1:34783700-34783722 GCCTGTCCACGTGTGTGTGTGGG - Intronic
905516249 1:38564172-38564194 GAGTGTGCATGTGTGTGAGGAGG + Intergenic
905867843 1:41385929-41385951 GTGTGTGCGTGTGTGTGTGGTGG + Intergenic
905892771 1:41527644-41527666 GTGTGAGAACGGGTGTGTGAGGG - Intronic
906665324 1:47617297-47617319 GGGTGTGCATGGGTGTATGGTGG + Intergenic
906693699 1:47810162-47810184 GCGCGCGCACGTGTGTGTGTTGG + Intronic
907341446 1:53738798-53738820 GCGGGTGTGCGGGTGTGTGGCGG - Intergenic
908131975 1:61082974-61082996 GCGTGTGCCCGCGGGTGGGGGGG + Intronic
908153704 1:61330440-61330462 GCGTGTGTGTGTGTGTGTGGGGG - Intronic
908696308 1:66845838-66845860 GCGTGTGTGTGTGTGTGTGGTGG + Intronic
909318311 1:74251665-74251687 GTGTGTGCACGTGTGGGAGGAGG + Intronic
909364103 1:74799354-74799376 GAGTGGGCCTGGGTGTGTGGAGG + Intergenic
909418597 1:75435856-75435878 GTGTGTGTATGTGTGTGTGGTGG - Intronic
913047783 1:115088992-115089014 GTGTGTGCACGGGAGACTGGAGG + Intronic
913244374 1:116858938-116858960 GTGTGCGCACGTGTGTGTGTAGG - Intergenic
915120493 1:153627335-153627357 GCGCGTGCAGGAGTGTGTGACGG - Intronic
916945491 1:169722145-169722167 GCGTGTGTGCGTGTGTGTGTTGG + Intronic
917414781 1:174797545-174797567 GTGTGTGCAGGAGGGTGTGGGGG + Intronic
917964678 1:180170906-180170928 GTGGGTGCATGGGTGAGTGGTGG + Intronic
919977534 1:202622652-202622674 GCTTGTGCAGCTGTGTGTGGGGG + Intronic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
921339929 1:214124621-214124643 GGGTGTGCATGAGTCTGTGGGGG + Intergenic
921373717 1:214451686-214451708 GTGTGGGTGCGGGTGTGTGGTGG - Intronic
921939264 1:220823271-220823293 GTGTGTGCATGCATGTGTGGGGG + Intergenic
921973188 1:221173470-221173492 GTGTGTGTATGTGTGTGTGGTGG + Intergenic
922648722 1:227318513-227318535 GCGTGTGCGCGCGCGTGTGCCGG - Intergenic
922739416 1:228006995-228007017 GCGGGTGCGCGGGTGTGCGCGGG - Intergenic
924251560 1:242138265-242138287 GGGTGTGCATGGGTGGTTGGGGG + Intronic
1062794875 10:337204-337226 GTGTGTGCAAGTGTGTGTGGTGG + Intronic
1062831479 10:608512-608534 GTGTGTGGGGGGGTGTGTGGGGG - Intronic
1063158285 10:3399593-3399615 GCGTGTGCATGTGTGCGTGCGGG + Intergenic
1064087378 10:12355486-12355508 GCGTGTGTATGTGTGTGTGGTGG + Intronic
1064120673 10:12615438-12615460 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1064329721 10:14382325-14382347 CAGTGTGCAAGGGCGTGTGGGGG - Intronic
1064543167 10:16425641-16425663 GTGCATGCATGGGTGTGTGGAGG - Intergenic
1064608089 10:17065137-17065159 GTCTGTGCATGTGTGTGTGGGGG - Intronic
1065701409 10:28429526-28429548 GTGCGTGCATGTGTGTGTGGGGG + Intergenic
1066467846 10:35669178-35669200 GCGTGTGCGTGCGTGTGTGTAGG + Intergenic
1066528955 10:36315317-36315339 GCGTGTGCGTGTGTGTGTGTTGG + Intergenic
1066628102 10:37430381-37430403 GTGTGTGCATGCGTGTGTGCAGG + Intergenic
1067013027 10:42732283-42732305 GGGTGTGTATGGGGGTGTGGTGG - Intergenic
1067683006 10:48451957-48451979 GTGTGTGCAATTGTGTGTGGCGG - Intronic
1067833295 10:49622396-49622418 ACCTGTGCACGTATGTGTGGAGG - Intronic
1068059531 10:52050051-52050073 GTGTGTTCATGTGTGTGTGGTGG + Intronic
1068550275 10:58400251-58400273 GGGTGGACATGGGTGTGTGGTGG + Intergenic
1069867723 10:71514041-71514063 GTGTGTGCATGGGTGTGTGTGGG - Intronic
1070676172 10:78413144-78413166 GCGCGTGCACATGTGTGTGTTGG + Intergenic
1070954534 10:80455152-80455174 GCCTGTGTGAGGGTGTGTGGAGG + Intronic
1070968677 10:80545698-80545720 GGGTGTGCATGGGTGAGTAGCGG + Intronic
1071513865 10:86284269-86284291 GTGTGTGCAAGTGTGTGTGATGG - Intronic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073070284 10:100788895-100788917 GGGTGTGCATGTGTGTGTGTCGG - Intronic
1073204564 10:101762075-101762097 GAGTGTGTACGAGTGTGTGAGGG - Intergenic
1073486222 10:103820632-103820654 GTGTGAGCAAGGGTGTGGGGAGG - Intronic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1074227484 10:111499936-111499958 ATGTGTGCATGTGTGTGTGGGGG + Intergenic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075226527 10:120634413-120634435 TCGTGTGTACGTGTGTGTGACGG - Intergenic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1075654870 10:124154554-124154576 GTGTGGGCATGCGTGTGTGGGGG - Intergenic
1075654938 10:124155074-124155096 GAGTGTGCATGCATGTGTGGGGG - Intergenic
1076461134 10:130648464-130648486 GCATGTGCACATGTGTGTGCAGG + Intergenic
1076605628 10:131687596-131687618 GAGTGTGCACCTGTGTGTGCTGG - Intergenic
1076778876 10:132713212-132713234 GGGTGTGCACACGTGTGTGTAGG + Intronic
1076988932 11:259156-259178 GGGTGTGCACAGGGGTGGGGTGG - Intergenic
1077090099 11:774497-774519 GCTTCTGCACGTGTGTGAGGAGG - Intronic
1077135706 11:997268-997290 GCGTGTCCCCGGGTGTGCTGGGG + Intronic
1077223777 11:1429016-1429038 GTGTGTACACGGGTGTGTCCTGG + Intronic
1077236797 11:1485782-1485804 GTGTGTGCAGGGGCGTGTGTGGG - Intronic
1077281025 11:1745821-1745843 GTGTGTGCACGGGTGTGTGAGGG - Intronic
1077281032 11:1745924-1745946 GTGTGTGCACAAGTGTGTGTGGG - Intronic
1077281047 11:1746216-1746238 GTGTGTGCACAAGTGTGTGAGGG - Intronic
1077305580 11:1867350-1867372 GTGTGTGCATGTGTGTGTGTGGG - Intronic
1077340392 11:2023844-2023866 GTGTGTGTACAGGTGTGGGGAGG + Intergenic
1077340402 11:2023913-2023935 GGGTGTGTGCGTGTGTGTGGTGG + Intergenic
1077390885 11:2300206-2300228 GGGTGGGCAGGGGTGTGTGAGGG + Intronic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1079296574 11:19240658-19240680 GCCTGTGCACGTGTGTGTAAGGG - Intronic
1080170718 11:29298935-29298957 GTGTGTGCACAGGTATGTGGGGG + Intergenic
1081049695 11:38322965-38322987 GCGTGTGTGTGTGTGTGTGGTGG + Intergenic
1081488147 11:43547525-43547547 GCGTGTGCTCGGGGGTGGGGCGG - Intergenic
1081644428 11:44779736-44779758 AGGTGTGCACAGGTATGTGGGGG - Intronic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081837305 11:46166471-46166493 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1081994925 11:47357982-47358004 GTGTGAGCAGGTGTGTGTGGGGG - Intronic
1084009944 11:66342029-66342051 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1084128915 11:67118862-67118884 GTGTGTGTGAGGGTGTGTGGGGG + Intergenic
1084146816 11:67269452-67269474 TGGTGTGCAGGGGTGGGTGGAGG - Intronic
1084441759 11:69178684-69178706 GCGGGTGCACAGGGCTGTGGGGG - Intergenic
1084523479 11:69680849-69680871 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1084708474 11:70829599-70829621 GCCTGTGCAGGGGTGAGGGGCGG + Intronic
1085972540 11:81611120-81611142 GTGTGTGCATGTGTGTGTGTAGG + Intergenic
1086806316 11:91247249-91247271 ACGTTTGCATGTGTGTGTGGAGG + Intergenic
1088884282 11:113994775-113994797 GCATGGGCACAGGTGTGTGATGG - Intergenic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089398477 11:118151107-118151129 GTGTGTGCACGTGTGTAAGGGGG - Intronic
1089584500 11:119501941-119501963 GTGTGTGAACGCGTGTGTGTGGG - Intergenic
1091077461 11:132633713-132633735 GGGTGTGTATGGGTGTGGGGTGG + Intronic
1091150741 11:133326334-133326356 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1091220176 11:133926027-133926049 ACATGTGCACAGGAGTGTGGGGG - Intronic
1091224461 11:133949311-133949333 GCGTGCGCATGTGTGTGTGAAGG - Intronic
1202823377 11_KI270721v1_random:79033-79055 GTGTGTGTACAGGTGTGGGGAGG + Intergenic
1202823387 11_KI270721v1_random:79102-79124 GGGTGTGTGCGTGTGTGTGGTGG + Intergenic
1091594919 12:1871541-1871563 GCGTGTGTACACGTGTGTGCTGG + Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092262291 12:6959208-6959230 GTGTGTGAATGTGTGTGTGGCGG - Intronic
1092299743 12:7235551-7235573 GTGTGTGCACACGTGTGTGTTGG - Intergenic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1092940507 12:13403193-13403215 GCATGTGCATATGTGTGTGGGGG + Intergenic
1093159694 12:15731851-15731873 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1095044484 12:37485671-37485693 GAGTGTGCAAGGGAATGTGGTGG - Intergenic
1095438640 12:42219619-42219641 GTGTGTGCATGTGTGTGTGCAGG - Intronic
1095976227 12:47942640-47942662 AGGGGTGCGCGGGTGTGTGGGGG - Intronic
1096252281 12:50040906-50040928 GGGTGTGTGTGGGTGTGTGGGGG - Intergenic
1096558096 12:52416272-52416294 GTGTATGCATGTGTGTGTGGGGG + Intergenic
1096676863 12:53230775-53230797 GGGTGTGCCGGGGTGTGGGGGGG + Intronic
1096795891 12:54077348-54077370 CCGTGGGCAGGGGTGTGTGGAGG + Intergenic
1097063010 12:56300061-56300083 GGGTGCGCACGGGTGTGGGAGGG + Intronic
1097823388 12:64150138-64150160 GCATGTGCACGTGTGTGGGTGGG + Exonic
1099026445 12:77469965-77469987 GTGTGTGCAGGGGCGGGTGGGGG + Intergenic
1102422365 12:112814078-112814100 GAGTGTGCACGAGTGTGTAGGGG + Intronic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102902031 12:116646422-116646444 GTGTGTGCACGTGTATGTGTGGG - Intergenic
1102949415 12:117020074-117020096 CCGTGCGCACAGGTGTGTGCTGG - Intronic
1103197907 12:119061317-119061339 GCGTGTGCACTTGGGTGTGTTGG + Intronic
1104405382 12:128512222-128512244 GCAGGTGCACGGGGATGTGGGGG - Intronic
1104759893 12:131290804-131290826 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104759894 12:131290816-131290838 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104759895 12:131290828-131290850 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
1104820829 12:131676332-131676354 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104820830 12:131676344-131676366 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104820832 12:131676366-131676388 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1104944931 12:132411324-132411346 ACGTGTGCACGGGTGCGTGTGGG - Intergenic
1104944942 12:132411378-132411400 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104944969 12:132411589-132411611 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104980531 12:132571419-132571441 GCGTGTGCTGGTGTGTGTGCTGG - Exonic
1105474428 13:20718487-20718509 GAGTGTGGGCAGGTGTGTGGGGG - Intronic
1105474452 13:20718584-20718606 GAGTGTGGGCAGGTGTGTGGGGG - Intronic
1106136195 13:26975588-26975610 GTGTGTGTAGGTGTGTGTGGGGG - Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1107022169 13:35763580-35763602 GCGTGTGTATAGGTGTGTAGGGG - Intergenic
1109417171 13:62055928-62055950 GTGTGTGTATGTGTGTGTGGTGG - Intergenic
1110408615 13:75179109-75179131 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1110993985 13:82081663-82081685 GTGTGTGCGTGGATGTGTGGGGG + Intergenic
1111076244 13:83239806-83239828 GTGTGCGCATGTGTGTGTGGTGG - Intergenic
1111641416 13:90975377-90975399 GAGTTTGCAGGGGTGTGTGGAGG - Intergenic
1111981868 13:95025210-95025232 GTGTGTGTGGGGGTGTGTGGGGG - Intronic
1111981874 13:95025222-95025244 GTGTGTGTATGGGTGTGTGTGGG - Intronic
1111981929 13:95025407-95025429 GGGTGTGTATGGGTGTGTGGTGG - Intronic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1112439389 13:99415172-99415194 GCATGTGCATGGGTGTGAGTGGG - Intergenic
1112439394 13:99415201-99415223 GTGTGTGAATGGGTGTGTGTGGG - Intergenic
1112503154 13:99957363-99957385 GCGCGTGAGCGTGTGTGTGGGGG + Intergenic
1112944828 13:104915370-104915392 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1113391882 13:109905719-109905741 GGGAGGGCAAGGGTGTGTGGAGG - Intergenic
1113598931 13:111554654-111554676 GGGTGTGAACGTGTGTGGGGAGG - Intergenic
1113870545 13:113557023-113557045 GTGTGTGCACAGGTATGTGTAGG + Intergenic
1113870563 13:113557184-113557206 GTGTGTGCACATGTGTGTAGGGG + Intergenic
1113870567 13:113557260-113557282 GTGTGTGCACAGGTGTGTCCAGG + Intergenic
1113963943 13:114141306-114141328 GTGTGTGCATGTGTGTGTGAGGG - Intergenic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1116530354 14:45965255-45965277 GTGTGTGCGCGTGTGTGTGCTGG + Intergenic
1117895863 14:60485861-60485883 GCGTGTGCGTGGGTGGGAGGGGG - Intronic
1117971713 14:61257630-61257652 GCGTGTGTGTGTGTGTGTGGGGG - Intronic
1118181035 14:63493486-63493508 GTGTGTGTGCGTGTGTGTGGTGG + Intronic
1118917048 14:70116359-70116381 GTGTGTGCACGTTTGTGTGCAGG + Intronic
1119695932 14:76713477-76713499 GTGTGTGCACGGATGTGTGCTGG - Intergenic
1119738838 14:77000772-77000794 GCGTGTGCAAGTGTGTCTGCAGG - Intergenic
1122792408 14:104189828-104189850 CCGTGTGCATGCGTGTGTGCGGG - Intergenic
1122979773 14:105186275-105186297 GTGTGTGGAGGTGTGTGTGGGGG + Intergenic
1122979783 14:105186310-105186332 GGGTGTACATGAGTGTGTGGGGG + Intergenic
1122998737 14:105280496-105280518 GCGTGAGCCTGGGTGTGTGGTGG + Intronic
1123054600 14:105563166-105563188 GGGTGTGTAAGGGTGTGAGGGGG + Intergenic
1123207235 14:106725324-106725346 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1123212256 14:106772318-106772340 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1123782216 15:23639803-23639825 AGGTGTGCACAGCTGTGTGGCGG + Intergenic
1124200186 15:27672757-27672779 GCATGTGCATGTGTGTGTGTGGG - Intergenic
1124250710 15:28104953-28104975 GTGTGTGTACATGTGTGTGGTGG + Intergenic
1124373174 15:29115010-29115032 GTGTGTGTAGGGGTGTGTGAAGG + Intronic
1124421783 15:29529235-29529257 GGGTGTGGAGGGGTGTGTGAGGG + Intronic
1124631686 15:31341350-31341372 GTGTGTGTACGTGTGTGTGTCGG + Intronic
1124827742 15:33115499-33115521 GTGTGTGCGTGTGTGTGTGGGGG - Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1126290421 15:47070380-47070402 GAGTGTGCAAGGGATTGTGGTGG + Intergenic
1126408332 15:48345906-48345928 GGCTGTGCACGTGTGTGAGGAGG - Intergenic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1129104578 15:73297193-73297215 GGGTGTGGAAAGGTGTGTGGTGG + Intronic
1130185356 15:81675777-81675799 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
1130447703 15:84019062-84019084 GTGTGTGTATGTGTGTGTGGTGG - Intronic
1130836663 15:87656475-87656497 GCATGGGCATGTGTGTGTGGAGG + Intergenic
1130979994 15:88805827-88805849 AGGTGTGCCTGGGTGTGTGGAGG - Intronic
1131107877 15:89747029-89747051 GCATGCGCATGTGTGTGTGGTGG - Intergenic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1131619459 15:94052156-94052178 GTGAGTGCATGTGTGTGTGGGGG - Intergenic
1132100859 15:99021968-99021990 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1132353304 15:101154015-101154037 GTGGGTGCAGGGGTGTGTGGGGG - Intergenic
1132599493 16:767553-767575 GCGTGTGGGGGGGTGCGTGGAGG + Intronic
1132606994 16:797742-797764 CCGAGTGCAGGTGTGTGTGGGGG + Exonic
1132613032 16:827126-827148 ACCTGTGCACGTGTGTGAGGTGG + Intergenic
1132649288 16:1013304-1013326 CCATGTGCACGGGTGTGTCCTGG - Intergenic
1132976074 16:2711791-2711813 GTGTGTGCACGGGTGCGTGTGGG + Intergenic
1133045697 16:3087211-3087233 GGGTGTGCTCGAGGGTGTGGGGG + Intergenic
1133283292 16:4679138-4679160 GCGTGTGCTCAGGTTTTTGGTGG + Intronic
1134116218 16:11550781-11550803 GTATGTGGCCGGGTGTGTGGTGG - Intronic
1134300735 16:12988407-12988429 GAGTGATCACGGGTGTTTGGAGG - Intronic
1136114989 16:28088946-28088968 GTGTGTGTGGGGGTGTGTGGGGG - Intergenic
1136690410 16:32024496-32024518 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136724675 16:32348499-32348521 GAGTGTGTGCGGGTGTGTGAGGG - Intergenic
1136790999 16:32968060-32968082 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136843002 16:33554539-33554561 GAGTGTGTGCGGGTGTGTGAGGG - Intergenic
1136878814 16:33885872-33885894 GTGTGTGCACGTATGTGTGCTGG + Intergenic
1137037012 16:35576159-35576181 GCAGGGGCACGGGTGTGGGGGGG + Intergenic
1137400188 16:48146956-48146978 GTGTGTGCGTGGGTGTGTGTGGG - Intronic
1137592326 16:49701248-49701270 GCATGCGCACGTGTGTGTGTAGG + Intronic
1137788570 16:51155519-51155541 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1137793570 16:51195914-51195936 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1138552232 16:57754194-57754216 GCCTGTGCCCTGGTGTGTGGGGG + Intronic
1139037260 16:62962448-62962470 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1139199423 16:64957585-64957607 GTGTGTGCACGGGCATGTGTGGG - Intronic
1140043603 16:71425436-71425458 GCGAGTGGATGGGTGGGTGGAGG - Intergenic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1140263825 16:73403424-73403446 GCATCTGCACGGGTGTGTGAAGG + Intergenic
1140513581 16:75526223-75526245 GAGTGTGCATGTGTGTGTGTGGG + Intergenic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1140921982 16:79547212-79547234 GTGTGTGTAGGGGTGTGTGTAGG - Intergenic
1141035761 16:80624051-80624073 GAGTATGCAGGGGTGTGAGGGGG - Intronic
1141307605 16:82881180-82881202 GCATGTGCTTGGGTGTGTAGAGG + Intronic
1141441592 16:84032932-84032954 GGGTGTGCATGGGTGGGTGTGGG + Intronic
1141481541 16:84309835-84309857 GCGTGTGTACATGTGTGTGTGGG + Intronic
1141481543 16:84309837-84309859 GTGTGTACATGTGTGTGTGGGGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1142312805 16:89323697-89323719 GAACGTGCAGGGGTGTGTGGAGG - Intronic
1142410629 16:89914484-89914506 GTGTGTGCGCCTGTGTGTGGGGG + Intronic
1203001755 16_KI270728v1_random:169256-169278 GAGTGTGTGCGGGTGTGTGAGGG + Intergenic
1203093206 16_KI270728v1_random:1229517-1229539 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1203133358 16_KI270728v1_random:1705662-1705684 GAGTGTGTGCGGGTGTGTGAGGG + Intergenic
1203153167 16_KI270728v1_random:1854837-1854859 GAGTGTGTGCGGGTGTGTGAGGG - Intergenic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142639170 17:1275696-1275718 GTGTGTGAATGTGTGTGTGGGGG + Intergenic
1142753026 17:1999677-1999699 GCCTGTGCGTGTGTGTGTGGGGG - Intronic
1143835267 17:9686951-9686973 GCATGTGCATGCGTGTGTGTGGG + Intronic
1144183836 17:12777545-12777567 GCTCTTCCACGGGTGTGTGGTGG + Intergenic
1145974101 17:28974429-28974451 GAGGGAGCACGGGTGTGTGAGGG - Intronic
1146613275 17:34327733-34327755 GTGTGTGTGCGTGTGTGTGGGGG + Intergenic
1146669939 17:34730241-34730263 GTGTGTGCATGTGTGTGTGCGGG - Intergenic
1147317136 17:39626475-39626497 GAGTGTGCAGGGGTGTGCCGGGG - Intergenic
1147331394 17:39701139-39701161 GCGTGGGGAAGGGTGAGTGGGGG + Intronic
1147585525 17:41652134-41652156 GTGTGTGCATGCGTGTGTGTTGG - Intergenic
1147875783 17:43619429-43619451 GTGTGTGCATGTGTGTATGGAGG - Intergenic
1147898543 17:43768607-43768629 GTGTGTGCATGGATGTGTGTGGG - Exonic
1148210154 17:45803790-45803812 GTGTGTGCATGTGTGTGTGTTGG + Intronic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148485578 17:47988678-47988700 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
1148736987 17:49870388-49870410 GTGTGTGCACGATTGTGAGGCGG + Intergenic
1148789829 17:50166912-50166934 GTGTGTGAAGGTGTGTGTGGGGG - Intronic
1148790152 17:50168280-50168302 GGGTGTGCAGGGATGTGGGGAGG + Intronic
1149659777 17:58328151-58328173 GTGTGTGCGCGAGTATGTGGAGG + Intronic
1150646112 17:66978478-66978500 GCCTGTGCTTTGGTGTGTGGGGG - Intronic
1150810956 17:68356842-68356864 GTGTGTGCACGGGTAGGTGGAGG - Intronic
1151212252 17:72553414-72553436 GTGTGTGGATGGGTGTGTGTGGG - Intergenic
1151212272 17:72553570-72553592 GTGTGTGGATGGGTGTGTGGGGG - Intergenic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151267979 17:72971303-72971325 GTGTGTGTATGTGTGTGTGGAGG - Intronic
1151326698 17:73384050-73384072 GCGTGGGGAGGGGTGGGTGGTGG - Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191881 17:78893081-78893103 GCGTGTGCAGGGGTGTGTGTGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152582009 17:81169978-81170000 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1152733417 17:81984828-81984850 GTGTGTGCAGGGGTGTGTGGGGG - Intronic
1152733446 17:81984936-81984958 GGGTGTGTGCGGGTGTGTGCGGG - Intronic
1152733457 17:81984995-81985017 GTGTGTGCAGGTGTGTGGGGGGG - Intronic
1152733473 17:81985047-81985069 GTGTGTGCGTGGGTGTGTGTGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152747342 17:82047433-82047455 ACTTGTGCGTGGGTGTGTGGAGG - Intergenic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1155116571 18:22774150-22774172 GCGTGTGCGTGTGTGTGTGGGGG + Intergenic
1155618736 18:27751310-27751332 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157515475 18:48308152-48308174 GTGTGTGTGTGGGTGTGTGGTGG - Intronic
1157688450 18:49661746-49661768 CCCTGTGCACGTGTGTGTGCTGG + Intergenic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1158429205 18:57368963-57368985 GTGTGTGTATGTGTGTGTGGGGG - Intronic
1158939523 18:62394015-62394037 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
1159963647 18:74575737-74575759 GCGTGTGTGCGCGTGTGTGAAGG + Intronic
1160201720 18:76801830-76801852 AAGTGCGCACGGGTGTGCGGGGG + Intronic
1160404551 18:78636675-78636697 GAGTGTGCATGGGTGTGTAGAGG + Intergenic
1160412981 18:78687619-78687641 CCGGGTGCACCTGTGTGTGGTGG - Intergenic
1160523278 18:79521059-79521081 GTGTGTCCATGTGTGTGTGGGGG + Intronic
1160523296 18:79521173-79521195 GTGTGTCCATGTGTGTGTGGGGG + Intronic
1160523308 18:79521245-79521267 GTGTGTCCATGTGTGTGTGGGGG + Intronic
1160836049 19:1124866-1124888 GCCTGTGAACGGGTGGGTCGGGG + Intronic
1160960371 19:1718237-1718259 GTGGGTGAGCGGGTGTGTGGTGG + Intergenic
1161857191 19:6772743-6772765 GCGTGCGGGCGGGTGGGTGGTGG + Exonic
1161890190 19:7030344-7030366 ACGTGTGTATGTGTGTGTGGCGG - Intergenic
1161891259 19:7040390-7040412 ACGTGTGTATGTGTGTGTGGCGG + Intergenic
1161893344 19:7058851-7058873 ACGTGTGTATGTGTGTGTGGCGG + Intergenic
1162015291 19:7842902-7842924 GTGTGTGCATGTGTGTGTGAAGG + Intronic
1162301531 19:9847698-9847720 GTGTGTGCATGTGTGTGTGCTGG + Intronic
1162478423 19:10914461-10914483 GCGAGTGTACGTGTGTGAGGAGG + Intronic
1163822937 19:19506471-19506493 GAGCGTGCACAGGTGTGTGCAGG + Exonic
1165111734 19:33506495-33506517 GGGTGTGTATGGGTGTGTGTGGG - Intronic
1165153743 19:33775310-33775332 GCGTCTGCATGTGTGTGTCGGGG + Intergenic
1165531903 19:36409978-36410000 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
1166196185 19:41207340-41207362 GAGTGTGTATGTGTGTGTGGAGG - Exonic
1166799989 19:45450899-45450921 GCGTCTGCGCGGGCGTGGGGGGG - Intronic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
924991868 2:319375-319397 GTGTGTGCGTGGGTGTGTGCAGG + Intergenic
924991869 2:319387-319409 GTGTGTGCAGGCGTGTGTGCAGG + Intergenic
924991875 2:319411-319433 ACGTGTGTGCGGGTGTGTGGGGG + Intergenic
924991878 2:319433-319455 GTGTGTGCGCGGGTGTGTGCAGG + Intergenic
924991880 2:319445-319467 GTGTGTGCAGGCGTGTGTGCGGG + Intergenic
925126633 2:1461756-1461778 GTGTGTGCAGGTGTGTGTGTGGG - Intronic
925462033 2:4072006-4072028 AAGTGTGCATGTGTGTGTGGTGG + Intergenic
925465888 2:4107070-4107092 GCGCGTGCATGTGTGTGTAGGGG + Intergenic
926122495 2:10252429-10252451 GTGTGTGCATGTGCGTGTGGTGG + Intergenic
926152649 2:10433457-10433479 GCGTGTGTAGTGGTGTGTGAGGG + Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927921449 2:26975129-26975151 TGGTGTGCTTGGGTGTGTGGTGG + Intronic
928171307 2:29005288-29005310 GTGTGTGCATGTGTGTGTGTGGG + Intronic
928613161 2:33010362-33010384 AAGAGTGCATGGGTGTGTGGGGG + Intronic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929360185 2:41078797-41078819 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
929532186 2:42760277-42760299 CAGTGTGCAGGGGTGTGGGGAGG - Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
931516574 2:63053728-63053750 GCGTGTGCGTGTGTGTGTGCAGG + Intronic
931937497 2:67214868-67214890 GTGTGTGTATGGGTGTGTGTGGG - Intergenic
932129626 2:69176080-69176102 GTGTGTGTATGTGTGTGTGGGGG - Intronic
932231399 2:70087041-70087063 GCGCGTGCGCGAGGGTGTGGGGG - Intergenic
932234320 2:70108918-70108940 GCTTGTGTGTGGGTGTGTGGTGG + Intergenic
932300673 2:70664729-70664751 GAGTGTGCAAGTGTGTGTGTGGG + Intronic
932412178 2:71554007-71554029 GTGTGTGCACCAGTGGGTGGTGG - Intronic
932702925 2:74003188-74003210 GTGTGTGTGCGTGTGTGTGGTGG + Intronic
933858548 2:86441827-86441849 GCTGGGGCCCGGGTGTGTGGCGG + Intronic
934052201 2:88220371-88220393 GGGTGTGCATGGGGGTGAGGGGG - Intergenic
934987919 2:98900611-98900633 GCGTGTGCATGCGTGCGTGCAGG + Intronic
935888828 2:107653490-107653512 GTGTGTGTATGGGTGGGTGGGGG - Intergenic
935962498 2:108440677-108440699 GTGTGTGTATGTGTGTGTGGGGG - Intergenic
936394806 2:112116888-112116910 GAGTGTGCTGGGGTGGGTGGTGG + Exonic
936631911 2:114212536-114212558 GCATGTGCATGAGTGTGTGTGGG + Intergenic
936705218 2:115064554-115064576 GTGTGTGTAGGGGTGGGTGGTGG - Intronic
936705522 2:115067907-115067929 GGGTGTGTGGGGGTGTGTGGGGG + Intronic
937087776 2:119182608-119182630 GCGTGTGTAAGTGTGTGTTGGGG - Intergenic
937233328 2:120415462-120415484 GTGTGTACACGTGTGTTTGGAGG + Intergenic
937512225 2:122608954-122608976 GTGTGTGCATGTGTGTGTGTAGG - Intergenic
937645740 2:124264359-124264381 GTGTGTGCCTGTGTGTGTGGGGG - Intronic
937950856 2:127387383-127387405 GTGTGTGCGCGCGTGTGTGTCGG - Intronic
938410030 2:131055875-131055897 GTGCATGCACGTGTGTGTGGTGG + Intronic
939963060 2:148583262-148583284 GTGAGTGCAGGGGTGTGAGGTGG + Intergenic
939993029 2:148894015-148894037 GTGTGTGTATGTGTGTGTGGTGG - Intronic
940036327 2:149315621-149315643 GTGTGTGCATGAGTATGTGGCGG - Intergenic
940038169 2:149330947-149330969 GCGTGTGTACTCGTGTGTGTTGG + Intronic
942406667 2:175663246-175663268 CTATGTGCACGTGTGTGTGGAGG - Intergenic
943107592 2:183566137-183566159 GCGTGTGCACTGGAGTGCAGTGG + Intergenic
946009920 2:216556091-216556113 GCGTGTGCATAGGTGTGTACAGG + Intronic
946414972 2:219535362-219535384 CTGTGTGTACGTGTGTGTGGGGG + Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947084381 2:226434773-226434795 GTGTGTGTACATGTGTGTGGAGG - Intergenic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947572922 2:231249833-231249855 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947572934 2:231249870-231249892 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947572946 2:231249907-231249929 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947572958 2:231249944-231249966 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947572970 2:231249981-231250003 AGGTGTGCACGGGTGGGCGGTGG - Intronic
947744946 2:232502638-232502660 GTGTGCGCACGCGTGTGTGCAGG + Intergenic
948123304 2:235546635-235546657 GCGTGGTGACGGGTGTGTGGGGG + Intronic
948367246 2:237464946-237464968 GTGTGTGCGGGGGTGTGGGGGGG + Intergenic
948743250 2:240062897-240062919 GTGCGTGCATGTGTGTGTGGTGG + Intergenic
1168812015 20:710397-710419 GCGTGCGCGCGCGTGTCTGGGGG - Intergenic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170706016 20:18745484-18745506 GAGTGTGAACAGGTGTGGGGTGG + Intronic
1170882022 20:20305124-20305146 GCGTGTGCGGGGAAGTGTGGAGG - Intronic
1170933238 20:20787825-20787847 GTGTGTGCACGCCTGTGTGTGGG - Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171249053 20:23634977-23634999 GTGTGTGCACATATGTGTGGGGG - Intronic
1171255558 20:23686819-23686841 GCCTGTGTGTGGGTGTGTGGCGG - Intronic
1171262895 20:23748747-23748769 GCCTGTGCATGGATGTGTGGGGG - Intronic
1171435422 20:25118355-25118377 GGATGTGCACGTGAGTGTGGTGG - Intergenic
1171539024 20:25929283-25929305 GAGTGTGCAAGGGAATGTGGTGG - Intergenic
1171841974 20:30224614-30224636 GAGTGTGCAAGGGACTGTGGTGG - Intergenic
1173028669 20:39333925-39333947 GTGTGTGCATGTGTGTGTGCAGG - Intergenic
1173054322 20:39596761-39596783 GTGTGTGCACACGTGTGTGTGGG + Intergenic
1173742037 20:45407906-45407928 GCGTGTGTACGTGTTTGTGTGGG + Intronic
1174889869 20:54380063-54380085 ATGTGCGCACGTGTGTGTGGGGG - Intergenic
1175314938 20:58040545-58040567 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1175485267 20:59341592-59341614 GTGTGTGCATGTGTGTATGGGGG + Intergenic
1175657352 20:60782620-60782642 GAGCGTGCACACGTGTGTGGCGG + Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175787127 20:61718756-61718778 GTGTGTGCAGGGGTGTAGGGTGG - Exonic
1175850421 20:62087942-62087964 GCGTGTGCAGGTGAGTGTGCAGG - Intergenic
1175876018 20:62230398-62230420 GTGTGTGTATGGGTGTGTTGAGG - Intergenic
1175950839 20:62582281-62582303 GCGTGTGCCCCGGAGTGCGGGGG - Intergenic
1176020018 20:62957857-62957879 GCGTGTGCAAGTGTGTGTATGGG + Intronic
1176110661 20:63409313-63409335 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1176240769 20:64074920-64074942 GGGTGGGCATGGGTGGGTGGAGG - Intronic
1176960477 21:15153753-15153775 GCATGTGCAAGGGTGGGTGATGG + Intergenic
1177891795 21:26813570-26813592 GGGTGTGTATGTGTGTGTGGAGG + Intergenic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1178907553 21:36649241-36649263 GCATGTGTGCGTGTGTGTGGGGG - Intergenic
1179144883 21:38759250-38759272 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1179554353 21:42162923-42162945 GGCTGTGCAGGGGTGAGTGGGGG + Intergenic
1179827550 21:43975386-43975408 GTGTGTGCACTGGTGTGTGGTGG + Intronic
1179998322 21:44984156-44984178 GTGTGTGGGCGTGTGTGTGGGGG - Intergenic
1179998326 21:44984170-44984192 GCGTGTGTGTGGGTGTGTGTGGG - Intergenic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1180713181 22:17853944-17853966 GTGTGTTCACGGTTTTGTGGGGG + Intronic
1180950295 22:19717762-19717784 GTGTGTGCATGTGTGTTTGGTGG - Intronic
1181596730 22:23920123-23920145 GTGTGTGCGCGTGTGTGTGATGG + Intergenic
1183062139 22:35342707-35342729 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062151 22:35342778-35342800 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062162 22:35342863-35342885 GTGTGTGTAGGGGTGTGTGTAGG - Intronic
1183062168 22:35342903-35342925 ACGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062174 22:35342944-35342966 GTGTGTGTAGGGGTGTGTGTAGG - Intronic
1183062187 22:35343021-35343043 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062206 22:35343144-35343166 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062221 22:35343242-35343264 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062252 22:35343439-35343461 GTGTGTGTAGGTGTGTGTGGTGG - Intronic
1183062263 22:35343544-35343566 GTGTGTGTAGGTGTGTGTGGTGG - Intronic
1183062268 22:35343585-35343607 GTGTGTGTAGGGGTGTGTGTAGG - Intronic
1183062278 22:35343659-35343681 GTGTGTGTAAGGGTGTGTGTAGG - Intronic
1183062328 22:35344056-35344078 GTGTGTGTAGGGGTGTGTGTAGG - Intronic
1183214544 22:36470837-36470859 GCGTGTTCAAGCATGTGTGGAGG - Intronic
1183489478 22:38108942-38108964 GCGTGGGCACAGGAGAGTGGGGG + Intronic
1183588233 22:38765528-38765550 GTGTGTGCACCTGTGTCTGGAGG - Intronic
1184060779 22:42079736-42079758 GCGGGTGCCCGGGTGAGGGGCGG + Exonic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1184960327 22:47923850-47923872 GTGTGTGCTTGGGGGTGTGGGGG - Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185203999 22:49526348-49526370 GTGTGTGCACCTGTGTGTGCAGG + Intronic
949905667 3:8856352-8856374 GTGTGTGTGCGTGTGTGTGGGGG + Intronic
950726899 3:14922572-14922594 GTGTGTGCATGGGGGTGGGGTGG + Intronic
952504827 3:33998367-33998389 GGGTGTGCAAGGAAGTGTGGTGG + Intergenic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953369298 3:42373547-42373569 GGGTGTGCATGTGTGTGTGCAGG + Intergenic
953914290 3:46908802-46908824 GGATGTGCACGTGTGTGTGCAGG + Intergenic
954582327 3:51709714-51709736 GGGTGTGTGTGGGTGTGTGGGGG - Intronic
954745545 3:52785607-52785629 GTATGTGCACCTGTGTGTGGTGG + Intronic
956456512 3:69426336-69426358 GTGTGTGCATGTGTGTGTGTTGG + Intronic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
957597289 3:82283624-82283646 AAGTGTGCACTTGTGTGTGGTGG - Intergenic
958784071 3:98577550-98577572 GAGTGTGGAAGGCTGTGTGGAGG + Intronic
959117683 3:102196878-102196900 GTGTGTGCACATGTGTGTGATGG - Intronic
959158993 3:102700953-102700975 GTGTGTGCACATGTGTGTGATGG - Intergenic
960223150 3:115140539-115140561 GAGTGTGTATGTGTGTGTGGTGG + Intronic
960334310 3:116397392-116397414 GTGTGTGTATGTGTGTGTGGGGG - Intronic
960534408 3:118800831-118800853 GGGTGTGTATGTGTGTGTGGAGG - Intergenic
961357837 3:126350124-126350146 GCGAGGGCACAGGTATGTGGGGG - Intronic
961515520 3:127431340-127431362 GTGCGTGCACGTGTGTGTGCAGG + Intergenic
961781316 3:129322062-129322084 GAGTGGGCAGGGGTGTGTGCTGG - Intergenic
962281652 3:134056737-134056759 GTGTGTGAGTGGGTGTGTGGGGG + Intergenic
963084526 3:141424648-141424670 GCGTGTGTGTGTGTGTGTGGTGG + Intronic
963284749 3:143423202-143423224 GTGTGTGTACGTGTGTGTGAGGG - Intronic
966159213 3:176950345-176950367 GTGTGTGGGCGGGTGGGTGGTGG - Intergenic
967489700 3:190076166-190076188 GTGTGTGCATGTGTGTTTGGTGG - Intronic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
967778281 3:193407257-193407279 GTGTGTGCACGCATGTGTGTAGG - Intronic
968522725 4:1041331-1041353 GTGTGTGCATGTGTGTGTGTCGG + Intergenic
968523031 4:1042877-1042899 CAGTGTGCAGGGGTGTGTGTCGG - Intergenic
968548404 4:1210265-1210287 ACGTGGGCACGGGTGTGAGGAGG - Intergenic
968605921 4:1535424-1535446 ATGTGTGCACGTGTGTGTGCTGG + Intergenic
968619801 4:1598982-1599004 GCGTGCGCAGGGGTGCGTGCGGG + Intergenic
968627632 4:1634337-1634359 GTGTGTGGACGGGTGTGGAGGGG - Intronic
968950049 4:3685956-3685978 ATGTGTGCACACGTGTGTGGGGG - Intergenic
969184213 4:5463517-5463539 ACGTGTGCATATGTGTGTGGGGG - Intronic
969239914 4:5891161-5891183 GTGTGTGTATGTGTGTGTGGTGG - Intronic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969313630 4:6368717-6368739 GCGTGGCCACGGGTGGGAGGCGG - Intronic
969540173 4:7783853-7783875 GCGTGTGAAAGGGTCTTTGGGGG + Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
970017094 4:11524115-11524137 GGGTGGGCCCGAGTGTGTGGTGG - Intergenic
970050875 4:11913543-11913565 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
971403199 4:26295278-26295300 GTGTGTGCATGGGTGTGTGTGGG + Intronic
972171078 4:36346228-36346250 GTGTGTGCATGTGTCTGTGGGGG - Intergenic
972351436 4:38239790-38239812 GAGTGTGCACACGTGTGTGAAGG + Intergenic
973115775 4:46456625-46456647 GTGTGTGTATGTGTGTGTGGTGG - Intronic
973862321 4:55077762-55077784 GTGTGTGGATGGGTGTGTGGGGG + Intergenic
974540868 4:63233003-63233025 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
974622705 4:64381877-64381899 GCAAGTGCACGTGTGTGTGGGGG + Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976349945 4:84049829-84049851 GCGTGTGTATGTGTGTGTGTGGG + Intergenic
976955539 4:90893775-90893797 GCGTGTGTGTGTGTGTGTGGGGG + Intronic
977215151 4:94273777-94273799 GTGTGTGTAAGGGTGTGTGTCGG + Intronic
978471545 4:109073129-109073151 GCATGTGTATGTGTGTGTGGGGG + Intronic
978471552 4:109073158-109073180 GCATGTGCATGGGTGTTTGGTGG + Intronic
978620165 4:110629490-110629512 GCGTGTGAAGGTGTGTGTCGCGG + Intronic
979468131 4:121064732-121064754 GCGTGTGCGTGGGTTTGTGTGGG + Intronic
979882578 4:125980260-125980282 GCATGTGCATGTGTGTGGGGAGG + Intergenic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
984741261 4:183165547-183165569 GGGTGTGGAAGGGGGTGTGGGGG + Intronic
984867305 4:184292714-184292736 GAGTGTGTATGTGTGTGTGGAGG + Intergenic
985095174 4:186406209-186406231 GGGTGTGCGTGGGTGTGTGTGGG - Intergenic
985161261 4:187047253-187047275 GTGTGTGCGGGGGTGGGTGGGGG + Intergenic
985515988 5:344805-344827 GTGTGTGCGGGTGTGTGTGGGGG + Intronic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985516120 5:345570-345592 GGGTGTGTGTGGGTGTGTGGGGG + Intronic
985564851 5:610399-610421 GTGTGTGCAGAGGTGTGTGCAGG - Intergenic
985564882 5:610580-610602 GTGTGTGCAGAGGTGTGTGCAGG - Intergenic
985565126 5:611867-611889 GCGGGTGCTGGGGTGTCTGGAGG + Intergenic
985606504 5:861030-861052 GGGTGTGCAGGTGTGTATGGGGG - Intronic
985702413 5:1381593-1381615 GGATGTGCATGGGTGTGTGCCGG - Intergenic
985730525 5:1544880-1544902 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
985730556 5:1545135-1545157 GTGTGTGCAGGTGTGTGTGCAGG - Intergenic
985730564 5:1545213-1545235 GTGTGTGCAGGTGTGTTTGGAGG - Intergenic
985859542 5:2460025-2460047 GCCTGTGCATGCCTGTGTGGAGG + Intergenic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
986818829 5:11443345-11443367 GTGTGTGGGAGGGTGTGTGGGGG + Intronic
987390144 5:17367920-17367942 ACGTGTGAGCGTGTGTGTGGGGG + Intergenic
987872283 5:23636443-23636465 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
988909126 5:35822069-35822091 GTGTGTGAATGAGTGTGTGGAGG + Intergenic
989033993 5:37150509-37150531 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
992249661 5:74865309-74865331 ACGTGTGTACGGGTTTTTGGGGG - Intronic
992529378 5:77640367-77640389 GCGCGCGCACGTGTGTGTGCAGG - Intergenic
992766005 5:80000808-80000830 GTGTGTGCACTGGTGAGGGGAGG + Intronic
994690347 5:103011341-103011363 GTGTGTGTATGTGTGTGTGGCGG - Intronic
995700025 5:114925055-114925077 GCGTGCGTACGCGTGTGTGGTGG + Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
998394207 5:141807788-141807810 GCGTGTGTGTGTGTGTGTGGGGG - Intergenic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
999491044 5:152052140-152052162 GGGTGGGGACGGGCGTGTGGGGG - Intergenic
999601785 5:153274487-153274509 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001774194 5:174316367-174316389 GTGTGTGTATGTGTGTGTGGTGG + Intergenic
1001833973 5:174814920-174814942 GTGTGTGTACGTGTGTGTGTGGG - Intergenic
1002092016 5:176811332-176811354 GCGTGTGAGAGCGTGTGTGGCGG - Intronic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1002282112 5:178137196-178137218 GCCTGTCCTCGGGTGTGCGGCGG + Intronic
1002345969 5:178547680-178547702 GTGTGTGTGTGGGTGTGTGGGGG - Intronic
1002365041 5:178703228-178703250 CCCTGTGCACAGGTGTGCGGAGG + Intergenic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002833285 6:843659-843681 GCGTGTGCCTGGGTGGGTGGGGG + Intergenic
1003142542 6:3483339-3483361 ACTTGTGCAGGGGAGTGTGGAGG - Intergenic
1003283301 6:4712528-4712550 GCTTGTGCCCGGGTGGGAGGTGG - Intronic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004084291 6:12429515-12429537 GTGTGTGCACATGTGTGTGTTGG + Intergenic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1005227298 6:23657446-23657468 GCGTGTGTGTGGTTGTGTGGAGG - Intergenic
1005430445 6:25751120-25751142 GGGTGTGCATGGGTGTGTAGGGG + Intergenic
1006137800 6:31906485-31906507 GAGTCAGCAAGGGTGTGTGGAGG - Intronic
1006396612 6:33791415-33791437 GCATGTGGATGGTTGTGTGGAGG - Intergenic
1007325745 6:41058275-41058297 GTGTGTGTGTGGGTGTGTGGTGG - Intronic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007401271 6:41603977-41603999 GCATGTGCATGTGTGTGTGAAGG - Intergenic
1007600574 6:43078255-43078277 GTGTGTGCGCGCGTGTGTGTGGG + Intronic
1007600576 6:43078257-43078279 GTGTGCGCGCGTGTGTGTGGGGG + Intronic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1012930324 6:105309709-105309731 GAGTGTGCAAGAGTGTCTGGGGG - Intronic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1013786443 6:113786817-113786839 GTGTGTGCATGTGTGTGTGATGG + Intergenic
1013793955 6:113863948-113863970 GCATGTCCAGGGATGTGTGGTGG - Intergenic
1013919196 6:115380908-115380930 GTTTGTGCATGGGAGTGTGGAGG - Intergenic
1015953179 6:138574433-138574455 GAGTGTGCACAGATGTGTGGCGG - Intronic
1016329703 6:142944416-142944438 GTGTGTGTGTGGGTGTGTGGGGG - Intronic
1017769018 6:157630756-157630778 GGGTGTGTAAGGGTGTGTGTGGG - Intronic
1017769057 6:157631045-157631067 GGGTGTATAAGGGTGTGTGGGGG - Intronic
1017798504 6:157869848-157869870 GTGTGTGCGAGTGTGTGTGGGGG - Intronic
1017889514 6:158627116-158627138 GTGTGAGCAAGGGTGTGTGAGGG - Intronic
1018789937 6:167140615-167140637 GGCTGTGCACGGGTGGGTGCTGG - Intergenic
1018980676 6:168599452-168599474 GGGTGTGAGTGGGTGTGTGGGGG - Intronic
1018980689 6:168599525-168599547 GTGTGTGAGTGGGTGTGTGGGGG - Intronic
1018980704 6:168599598-168599620 GAGTGTGTGTGGGTGTGTGGGGG - Intronic
1019048697 6:169167302-169167324 ACCTGTGCACGCGAGTGTGGGGG + Intergenic
1019183283 6:170206170-170206192 GTGTGTGCATGGGTGTGTGTGGG + Intergenic
1019285917 7:222936-222958 ACGTGTGCATGTGTGTGTGAGGG + Intronic
1019292244 7:256484-256506 GCGGGAGCACGGGTGTGGGAGGG - Intronic
1019429335 7:991456-991478 GCGTGGGCAGGGGTGTGGGGCGG + Intergenic
1019553837 7:1618795-1618817 GTGTGTGGAGGGGTGTGTGTAGG + Intergenic
1019553872 7:1619032-1619054 GTGTGTGTAGGGGTGTGTGTAGG + Intergenic
1019553882 7:1619100-1619122 GTGTGTGTAGGGGTGTGTAGGGG + Intergenic
1019553885 7:1619110-1619132 GGGTGTGTAGGGGTGTGTAGGGG + Intergenic
1019553889 7:1619148-1619170 GTGTGTGTAGGGGTGTGTGTAGG + Intergenic
1019553905 7:1619237-1619259 GTGTGTGTAGGGGTGTGTGTAGG + Intergenic
1019565617 7:1677504-1677526 GACTGTGCAGGGGTGTGTGTAGG + Intergenic
1019748977 7:2717059-2717081 GCGTGGGTGCCGGTGTGTGGGGG - Intronic
1019872384 7:3776976-3776998 ACGTGAGCAAGTGTGTGTGGGGG - Intronic
1020033019 7:4946194-4946216 GTGTGTGCATGCGTGTGTGTGGG - Intronic
1020082667 7:5295244-5295266 GCGTGTGCGCGTGTGTTAGGAGG + Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1021485890 7:21168180-21168202 CCATGTGCACATGTGTGTGGGGG + Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1022335087 7:29414668-29414690 ACGTGTGCATGCGTGTGTTGGGG - Intronic
1022887654 7:34663075-34663097 GTGTGTGTATGTGTGTGTGGCGG + Intronic
1023035674 7:36129377-36129399 GCATGTGCAGGGGAGGGTGGGGG + Intergenic
1024473668 7:49788852-49788874 GTGTGTGAGCGTGTGTGTGGGGG + Intronic
1024607116 7:51031095-51031117 GTGTGTGCACAGGTATGTGTGGG + Intronic
1025290409 7:57715213-57715235 GAGTGTGCAAGGGAATGTGGTGG - Intergenic
1025652540 7:63484072-63484094 GTGTGTGTAGGTGTGTGTGGGGG + Intergenic
1026447268 7:70496021-70496043 ACGTGTGCATGTGTGTGGGGGGG - Intronic
1026890335 7:73977985-73978007 GTGTGTGCAAGTGTGTGTGCAGG + Intergenic
1026890342 7:73978145-73978167 GCGTTTGCAAGCGTGTGTGCAGG + Intergenic
1029696459 7:102216684-102216706 GCGTGTGGGAGTGTGTGTGGGGG - Intronic
1030742585 7:113127884-113127906 GCGTGTGTTTGTGTGTGTGGGGG - Intergenic
1030987045 7:116253844-116253866 GTGTGTGGGTGGGTGTGTGGGGG + Intronic
1030987469 7:116259386-116259408 ACATGTGCATGTGTGTGTGGTGG - Intergenic
1032453509 7:132054403-132054425 GTGTGTGTAAGTGTGTGTGGAGG - Intergenic
1032651603 7:133884615-133884637 GTGTGTGCGCGCGTGTGTGATGG + Intronic
1033422496 7:141216465-141216487 GTGTGTGTGTGGGTGTGTGGTGG + Intronic
1033601295 7:142890491-142890513 GCGTCTGCAGGTGTGTGTGCAGG - Intergenic
1033601318 7:142890921-142890943 TGGTGTGCATGTGTGTGTGGTGG - Intergenic
1033638066 7:143231117-143231139 GCGTGTGAGATGGTGTGTGGTGG - Intergenic
1034318629 7:150158863-150158885 CTGTGTGCACGTGTGTGTGTGGG - Intergenic
1034445430 7:151111581-151111603 GCGTGTGCACAGGGGGGTGAGGG - Intronic
1034480144 7:151313604-151313626 GCATGTGTATGGGTGTTTGGTGG + Intergenic
1034526857 7:151669963-151669985 GTGTGTGCACAGGTGTGTGCAGG - Intronic
1034774123 7:153808337-153808359 GTGTTTGCACGTGTGTGTGTGGG + Intergenic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035169906 7:157011308-157011330 GTGTGTGTGCGGGGGTGTGGGGG + Intergenic
1035226141 7:157433499-157433521 GTGTGTGCATGTGTGGGTGGGGG - Intergenic
1035243140 7:157545123-157545145 GTGTATGCATGGGTGTGTGCAGG + Intronic
1035243165 7:157545316-157545338 GGGTGTGTAGGTGTGTGTGGGGG + Intronic
1035464316 7:159064777-159064799 GCCTGTGCACAGCTGTGTGCTGG + Intronic
1035704261 8:1663075-1663097 GCGTTTGTACATGTGTGTGGGGG + Intronic
1035877402 8:3206381-3206403 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1035877409 8:3206443-3206465 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1035979062 8:4348591-4348613 GTGTGTGCGTGGGTGTGTTGGGG + Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1037382059 8:18296322-18296344 GCGTGTGTGTGTGTGTGTGGGGG + Intergenic
1037992814 8:23332691-23332713 GCATGTGTATGAGTGTGTGGGGG - Intronic
1038063705 8:23939596-23939618 GCGTGTGTGTGTGTGTGTGGGGG + Intergenic
1038379052 8:27075137-27075159 GCGGGTGGAAGGGTGCGTGGCGG - Intergenic
1038729009 8:30110379-30110401 GCGTGCGCGCGTGTGTGTAGTGG + Intronic
1039237025 8:35513044-35513066 AGGTGTGCATGGGAGTGTGGAGG - Intronic
1039440287 8:37590497-37590519 GAGTGTGCATGGGTGTGTGTGGG - Intergenic
1040978281 8:53217888-53217910 GAGTGTGCGCGTGTGTGGGGGGG + Intergenic
1041551833 8:59111577-59111599 GCATGTGTATGGGTGTGTGGGGG - Intronic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1043389261 8:79776367-79776389 GTGTATGCACATGTGTGTGGGGG - Intergenic
1044037122 8:87320600-87320622 GTATGTGCACGTGTGTGTGTGGG + Intronic
1044580731 8:93823421-93823443 GGGTGGGTAGGGGTGTGTGGGGG + Intergenic
1045768898 8:105710695-105710717 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1046010223 8:108537487-108537509 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1046619197 8:116509934-116509956 GTGTATGCACGTGTGTGTGAGGG - Intergenic
1046993868 8:120493460-120493482 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1047523588 8:125614502-125614524 GAGTGTGCAAGTGTGTGTGAGGG + Intergenic
1048493728 8:134918402-134918424 CTGTGTGCATGGGTGTGTGCAGG + Intergenic
1048840580 8:138562551-138562573 AAGTGTGGAAGGGTGTGTGGAGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048865394 8:138757310-138757332 GTGTGTGTATGTGTGTGTGGAGG + Intronic
1048871835 8:138805357-138805379 TGGTGTGCATGGGTGTGTGATGG + Intronic
1048936351 8:139360658-139360680 GAGTGTGCAGGAGTGGGTGGGGG - Intergenic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049254036 8:141604589-141604611 CCCTGTGCATGGGTGTGTGGGGG + Intergenic
1049291359 8:141804282-141804304 GTGTGGGCACGGGTTAGTGGAGG - Intergenic
1049356312 8:142190306-142190328 GCATGTGCACATATGTGTGGGGG - Intergenic
1049392828 8:142380942-142380964 GCAGGTGCATGTGTGTGTGGGGG - Intronic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049641242 8:143716928-143716950 GTGTGTGCGTGGGTGTGTGGGGG + Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1049826305 8:144670993-144671015 GTGTGAGCACATGTGTGTGGTGG - Intergenic
1049908672 9:244273-244295 GCGTGTGTGTGTGTGTGTGGTGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1051868623 9:21711005-21711027 GTGTGTGCTTGCGTGTGTGGGGG + Intergenic
1052132857 9:24870851-24870873 GTGTGTGTACGTGTGTGTGTTGG - Intergenic
1052996696 9:34555049-34555071 GCATGTTCCCGTGTGTGTGGTGG + Intronic
1053284774 9:36843136-36843158 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1053593127 9:39533681-39533703 CCGTGTGTACGTGTGTGTGTCGG - Intergenic
1053785512 9:41650019-41650041 CTGTGGGCAGGGGTGTGTGGAGG + Intergenic
1053850864 9:42288389-42288411 CCGTGTGCACGTGTGTGTGTCGG - Intergenic
1053875097 9:42536357-42536379 GTGTGTGTATGTGTGTGTGGAGG - Intergenic
1053886812 9:42649955-42649977 GGGTGTGCAGGTGTGGGTGGGGG - Intergenic
1054159519 9:61664154-61664176 CTGTGGGCAGGGGTGTGTGGAGG - Intergenic
1054174231 9:61863971-61863993 CTGTGGGCAGGGGTGTGTGGAGG + Intergenic
1054225831 9:62457405-62457427 GGGTGTGCAGGTGTGGGTGGGGG - Intergenic
1054236600 9:62565362-62565384 GTGTGTGTATGTGTGTGTGGAGG + Intergenic
1054449090 9:65393038-65393060 CTGTGGGCAGGGGTGTGTGGAGG + Intergenic
1054479293 9:65595157-65595179 CTGTGGGCAGGGGTGTGTGGAGG - Intergenic
1054573180 9:66831596-66831618 CCGTGTGCACGTGTGTGTGTCGG + Intergenic
1054663306 9:67716810-67716832 CTGTGGGCAGGGGTGTGTGGAGG - Intergenic
1056447471 9:86679651-86679673 GCGTGTAGAAGGGTGTGGGGGGG + Intergenic
1057270807 9:93650411-93650433 GCGTCTACACGGGTGTGTGCAGG - Intronic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059319856 9:113461221-113461243 GTGTGTGCACATGTGTGAGGTGG + Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1060201309 9:121653018-121653040 GTGTGTGCACAGGTGTGTGCTGG + Intronic
1060264797 9:122105202-122105224 GAGTGGGGCCGGGTGTGTGGTGG + Intergenic
1060321706 9:122567994-122568016 GTGTGTGCAGGAGTGAGTGGAGG + Exonic
1060816335 9:126637456-126637478 GCGTGTGCATTTGTGTGTGGGGG + Intronic
1061083525 9:128386155-128386177 GGGTGTGCCTGTGTGTGTGGAGG - Intronic
1061225548 9:129279010-129279032 GCTTGTGCAAGGCTGTGTGGGGG - Intergenic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1062070813 9:134554088-134554110 GAGTGAGCAGGGGGGTGTGGGGG + Intergenic
1062104264 9:134744498-134744520 GGGTGTGCATGAGTGTGTGCAGG - Intronic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062233754 9:135498297-135498319 GCGTGTGGTTGGGTGTATGGGGG + Intronic
1062253879 9:135611888-135611910 GTGTGTACAGGGGTGTGTGCAGG - Intergenic
1062253893 9:135611993-135612015 GAGTGTGCACGTGTGTGTGCAGG - Intergenic
1062285035 9:135769061-135769083 GCGTGTGCACACGTGGGTGACGG + Intronic
1062285042 9:135769101-135769123 GCGTGTGCACACGTGGGTGTCGG + Intronic
1062285079 9:135769301-135769323 GCGTGTGCACACGTGGGTGACGG + Intronic
1062325558 9:136010915-136010937 GTGTGTGCAGGGGTGTGGTGAGG - Exonic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062444160 9:136586469-136586491 GTGTGTGCCCGTGTGTGTAGAGG + Intergenic
1062595260 9:137296328-137296350 GAGTGTGCGGGGGTGGGTGGAGG + Intergenic
1185480175 X:440136-440158 GTGTGTGCACCTGTGTGTGTGGG - Intergenic
1185480190 X:440363-440385 GTGTGTGCACCTGTGTGTGGGGG - Intergenic
1185567992 X:1110848-1110870 GCGTGTGCATGTGTGTATGTAGG + Intergenic
1185589754 X:1267451-1267473 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185589770 X:1267704-1267726 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1185589800 X:1268225-1268247 GTGTGTGCAGGTGTGTGTGCAGG + Intergenic
1186015724 X:5191068-5191090 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1186837438 X:13451660-13451682 GAGTGTGAAGGGGTATGTGGTGG + Intergenic
1186861570 X:13677660-13677682 GTATGTGCGCGTGTGTGTGGGGG + Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1189241711 X:39529677-39529699 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1189306436 X:39990305-39990327 TCATGTTCAAGGGTGTGTGGAGG - Intergenic
1189549230 X:42076029-42076051 GTGTGTGTATGTGTGTGTGGGGG + Intergenic
1190826830 X:54025497-54025519 GCGAGTGAAGGGGTGTGTTGGGG - Intronic
1190933294 X:54969327-54969349 GCCTGTGCATGCGAGTGTGGGGG - Intronic
1192798472 X:74443991-74444013 GTGTGTGCATGTGTGTCTGGGGG + Intronic
1196644712 X:118105070-118105092 GTGTGTGCACAGGTGTGTGTTGG - Intronic
1198671802 X:139089146-139089168 GTGTGTGCACGCATGTGTGTTGG + Intronic
1199726228 X:150585097-150585119 GTGTGTGTATGTGTGTGTGGGGG + Intronic
1200267216 X:154652986-154653008 GCGTGTGCACAGTTGGGTGCTGG - Intronic