ID: 1151229917

View in Genome Browser
Species Human (GRCh38)
Location 17:72677178-72677200
Sequence ATCCTAGCACTGTGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 930
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 878}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151229911_1151229917 8 Left 1151229911 17:72677147-72677169 CCTAAGGGAAGCCTCTCTCAGAA 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1151229917 17:72677178-72677200 ATCCTAGCACTGTGGATGGAAGG 0: 1
1: 0
2: 2
3: 49
4: 878
1151229912_1151229917 -3 Left 1151229912 17:72677158-72677180 CCTCTCTCAGAACCCATCACATC 0: 1
1: 0
2: 1
3: 18
4: 241
Right 1151229917 17:72677178-72677200 ATCCTAGCACTGTGGATGGAAGG 0: 1
1: 0
2: 2
3: 49
4: 878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151229917 Original CRISPR ATCCTAGCACTGTGGATGGA AGG Intronic
900250613 1:1666808-1666830 ATCCCAGCACTGTGGAGGCCGGG + Intronic
900261257 1:1730961-1730983 ATCCCAGCACTGTGGGAGGTCGG + Intronic
900999806 1:6143283-6143305 ATCCCAGCACTGTGGGAGGCCGG - Intronic
901136386 1:6999633-6999655 ATCCTAGCACTTTGGGAGGCTGG - Intronic
901543686 1:9939312-9939334 ATCCTAGCACTTTGGGAGGCTGG - Intronic
903796777 1:25934953-25934975 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
903841181 1:26242012-26242034 ATCCTAGCACTTTGGGAGGCGGG - Intronic
904490624 1:30856849-30856871 ATCCTAGCTCTGTGGCTCCACGG - Intergenic
904522130 1:31103750-31103772 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
904733160 1:32610440-32610462 ATCCTAGCACTTTGGGAGGCCGG - Intronic
904743057 1:32693335-32693357 ATCCCAGCACTTTGGTTGGGAGG - Intronic
904946160 1:34200295-34200317 AGCCTGGCACTATGGATGGTTGG + Intronic
905163921 1:36064910-36064932 ATCCCAGCACTTTGGGTGGGCGG + Exonic
905682110 1:39880963-39880985 ATCCTAGCACTTTGGGAGGCTGG + Intronic
905853152 1:41289253-41289275 ATCCCAGCACTTTGGGAGGACGG - Intergenic
906105106 1:43286819-43286841 ATGGTAGAACTGTGGCTGGAAGG + Intergenic
906321049 1:44815822-44815844 ATCCCAGCACTTTGGGAGGACGG - Intergenic
906354491 1:45092553-45092575 ATCCTAGCACTTTGTAAGGCTGG - Intronic
907208847 1:52800554-52800576 ATCCTAGCACTTTGGGAGGCCGG + Intronic
908126931 1:61041609-61041631 ATCCCAGCACTTTGGGAGGAGGG + Intronic
908271522 1:62427218-62427240 ATCCCAGCACTTTGGGTGGCTGG + Intergenic
908724239 1:67157870-67157892 ATTCTAGCACTGAGGATAAAGGG - Intronic
908854218 1:68406298-68406320 ATCCCAGCACTGTGGGAGGCTGG + Intergenic
909633528 1:77790994-77791016 ATCCCAGCACTTTGGCTGGCAGG + Intronic
909659126 1:78062755-78062777 ATCCCAGCACTTTGGGTGGGTGG - Intronic
911155666 1:94634421-94634443 ATCTTAGCACTTTGGAAGGGAGG - Intergenic
911624409 1:100104716-100104738 ATCCCAGCACTTTGGGTGGGAGG - Intronic
911832849 1:102576690-102576712 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
911898238 1:103467175-103467197 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
912349250 1:108996304-108996326 ATCCCAGCACTTTGGGCGGAAGG - Intronic
912372279 1:109183232-109183254 ATCCCAGCACTTTGGGTGGGTGG + Intronic
914232738 1:145779426-145779448 ATCCTAGCACTTTGGGAGGGCGG - Intronic
914763113 1:150615074-150615096 ATCCTAGCACTTTGGGAGGCTGG - Intronic
914885046 1:151577768-151577790 ATCCTAGCACTTTGGGAGGCCGG + Intronic
915231354 1:154447959-154447981 ATCCCAGCACTTTGGGAGGATGG - Intronic
915378208 1:155416782-155416804 ATCCCAGCACTTTGGGTGGGCGG - Intronic
915429647 1:155856486-155856508 ATCCTAGCACTTTGGGAGGCTGG - Intronic
915453636 1:156024396-156024418 ATCCCAGCACCTTGGAAGGAAGG + Intergenic
915714804 1:157934833-157934855 ATTCTAGCACTTTGGAAGGCTGG - Intergenic
916042507 1:160973371-160973393 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
916156303 1:161852868-161852890 ATCCTAGCACTTTGGGAGGCTGG - Intronic
916396902 1:164400820-164400842 ATCCTAGCACTTTGGGAGGCGGG + Intergenic
917200672 1:172511019-172511041 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
917329074 1:173863054-173863076 ATCCCAGCACTTTGGGAGGATGG + Intergenic
917533784 1:175859857-175859879 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
917855008 1:179092598-179092620 ATCCTAGCACTTTGGGAGGCGGG + Intronic
917889788 1:179424680-179424702 ATCCTAGCACTTTGGGAGGCCGG - Intronic
917956744 1:180107414-180107436 ATCCTAGCACTTTGGGAGGCCGG + Intronic
918867774 1:189925581-189925603 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
919324313 1:196086955-196086977 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
919921370 1:202168393-202168415 ATCCCAGCACTTTGGGTGGTGGG - Intergenic
920233456 1:204485821-204485843 ATCCTAGCACTTTGGGAGGCCGG - Intronic
920935319 1:210428139-210428161 ATTGTAAAACTGTGGATGGACGG - Intronic
921036654 1:211385273-211385295 ATCCTAGCACTTGGGAAGGCCGG - Intergenic
921206940 1:212857636-212857658 ATCCCAGCACTGTGGGAGGCCGG - Intergenic
921237122 1:213144503-213144525 ATCCCAGCACTGTGGGAGGCTGG - Intronic
921459288 1:215410086-215410108 ATCCCAGCACTTTGGGTGGCTGG - Intergenic
921552422 1:216554199-216554221 ATCCCAGCACTTTGGAAGGCTGG + Intronic
921860583 1:220038628-220038650 ATCCTAGCACTTTGGGAGGCCGG - Intronic
921947638 1:220896959-220896981 ATCCTAGCACTTTGGGAGGCGGG + Intergenic
922043610 1:221921788-221921810 ATCCCAGCACTCAGGATGCAAGG + Intergenic
922291945 1:224215581-224215603 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
922314348 1:224429009-224429031 ATCCCAGCACTTTGGAAGGCTGG + Intronic
922683793 1:227623257-227623279 ATAATAGCACTGTCTATGGAAGG + Intronic
922844818 1:228676397-228676419 ATCCTAGCACTTTGGATTTTGGG + Intergenic
923161842 1:231321391-231321413 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
923647544 1:235839407-235839429 ATCCCAGCACTTTGGAAGGGTGG - Intronic
923813492 1:237347072-237347094 ATCCTAGCACTTTGGGAGGCAGG + Intronic
923835663 1:237608448-237608470 ATCCCAGCACTTTGGGAGGAAGG + Intronic
924226383 1:241925295-241925317 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
924530521 1:244889884-244889906 ATCCTAGCACTTTGGGAGAATGG - Intergenic
924725505 1:246666097-246666119 ATCTAAGCATTGTGGATGGAAGG + Exonic
924945043 1:248840342-248840364 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1062817663 10:512659-512681 ATCCCAGCACTTTGGAAGGTCGG + Intronic
1063040339 10:2331526-2331548 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1063069091 10:2641511-2641533 ATCCCAGCACTTTGGGAGGACGG + Intergenic
1064656997 10:17566344-17566366 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
1064724031 10:18259311-18259333 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1064790593 10:18953999-18954021 ATCCTATGACTGTGTATGGTTGG + Intergenic
1064951594 10:20857073-20857095 ATCCCAGCACTGTGGGAGGCGGG - Intronic
1065244739 10:23745771-23745793 ATCATAGCCTTGTAGATGGATGG + Intronic
1065334616 10:24643964-24643986 ATCCTAGCACTTTGGGTGGGAGG - Intronic
1065347102 10:24759197-24759219 ATCCTAGCATTTTGGAAGGCTGG + Intergenic
1065402187 10:25317973-25317995 ATCCTAGCACTTTGGGAGGCGGG - Intronic
1065581909 10:27180642-27180664 ATCCTGGCACTTTGGGTGGCTGG - Intronic
1065595543 10:27307309-27307331 ATCACAGAACTGGGGATGGAGGG + Intergenic
1065852368 10:29801458-29801480 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
1066115618 10:32236737-32236759 ATCCCAGCACTTTGGTTGGGAGG - Intergenic
1067115091 10:43429372-43429394 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1067915215 10:50390518-50390540 GTCCTAGCTCTGTGGAAGGCTGG + Intronic
1068121911 10:52789379-52789401 ATCCTAGCACTCTGGGAGGCCGG - Intergenic
1068267361 10:54669798-54669820 ATCCTAGCACTTTGGGAGGTTGG + Intronic
1068982603 10:63077138-63077160 ATCCGAGCACTTTGGAAGGCGGG + Intergenic
1069494574 10:68891549-68891571 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1069505171 10:68991016-68991038 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1069525047 10:69162240-69162262 ATCCTAGCACTCTGGAAGGCCGG - Intronic
1069541503 10:69297640-69297662 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1069712023 10:70495750-70495772 ATCCCAGCACTGTGGGAGGCTGG + Intronic
1069995436 10:72339281-72339303 ATCCCAGCACTTTGGGAGGAAGG + Intronic
1070118748 10:73554866-73554888 ATCCCAGCACTTTGGGAGGATGG + Intronic
1070267160 10:74914837-74914859 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1070271727 10:74963037-74963059 ACAATAGCTCTGTGGATGGAGGG - Intronic
1070298422 10:75184811-75184833 ATCCTAGCACTTTGGGAGGCGGG + Intergenic
1070311650 10:75277752-75277774 ATCCTAGCACTTTGGGAGGGCGG - Intergenic
1070496817 10:77032099-77032121 ATCTTGGCATTGTGGATTGAAGG - Intronic
1070546199 10:77454859-77454881 ATCCTAGGGCTGTGGATCCAAGG + Intronic
1070611856 10:77938934-77938956 ATCCCAGCACTTTGGAAGGTGGG + Intergenic
1070628476 10:78067838-78067860 AACCTAGCTCTGTGGAAGGCAGG + Intergenic
1072046009 10:91655860-91655882 ATCCTAGCACTTTGGGAGGCGGG + Intergenic
1072052754 10:91722792-91722814 ATCCCAGCACTTTGGGTGGGCGG + Intergenic
1072143908 10:92616087-92616109 ATCCCAGCACTTTGGAAGGCCGG - Intronic
1072175350 10:92915287-92915309 ATCCTAGCACTCTGGGAGGCTGG + Intronic
1072494772 10:95946034-95946056 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1072653223 10:97311787-97311809 ATCCCAGCACTGTGGGAGGATGG + Intergenic
1073000641 10:100283426-100283448 ATCCTAGCACTTTGGGAGGCAGG - Intronic
1073200487 10:101731243-101731265 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1073849040 10:107593016-107593038 ATCCCAGCACTGTGGGAGTACGG - Intergenic
1073903981 10:108255474-108255496 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
1074502058 10:114034858-114034880 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1075037590 10:119082072-119082094 ATCCCAGCACTTTGGGTGGCTGG + Intergenic
1075531426 10:123233386-123233408 ATCCTAGCACTTTGGGAGGGAGG - Intergenic
1075780977 10:125016947-125016969 CTCTAAGCACTGTGGATGGAAGG + Intronic
1075977440 10:126707933-126707955 ATCCTAGCACTTTAGGTGGGTGG - Intergenic
1076334122 10:129693650-129693672 ATCCCAGCACTTTGGGAGGATGG + Intronic
1076887782 10:133270502-133270524 ATGTCAGCCCTGTGGATGGACGG + Exonic
1078276256 11:9850508-9850530 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1078768381 11:14322176-14322198 ATCCTAGCACTTTGGGAGGCAGG + Intronic
1078922098 11:15840445-15840467 CTCCTAACACTGTGGTTGGCTGG - Intergenic
1079051107 11:17160575-17160597 ATCCTAGCACTTTGGGAGGCAGG + Intronic
1079184605 11:18225200-18225222 ATCCTAGCACTTTAGAAGGTGGG - Intronic
1079936433 11:26622354-26622376 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1082719353 11:56654954-56654976 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1082846013 11:57726158-57726180 ATCCTAGCACTTTGGTAGGCTGG + Intronic
1083801713 11:65050126-65050148 ATCCCAGCACTTTGGAAGGCCGG - Intronic
1084055601 11:66630326-66630348 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1084127660 11:67110995-67111017 ATCCTAGCACTTTGGGAGGCAGG + Intergenic
1084301221 11:68253939-68253961 ATCCTAGCACTTTGGAGGCGAGG - Intergenic
1084326059 11:68400796-68400818 ATCCCAGCACTTTGGAAGGAAGG + Intronic
1084626355 11:70310863-70310885 GTCCTTGGCCTGTGGATGGACGG - Intronic
1084851972 11:71949163-71949185 ATCCTAGCACTTTGGCAGGCTGG + Intronic
1084995743 11:72976530-72976552 ATCCCAGCACTTTGGAAGGCGGG - Intronic
1085369694 11:75989299-75989321 ATCCTAGCACTTTGGGAGGTAGG - Intronic
1085568172 11:77534659-77534681 ATCCCAGCACTTTGGAAGGTGGG + Intronic
1085569254 11:77544881-77544903 ATCCTAGCACTTTGGGAGGCAGG + Intronic
1085759003 11:79225733-79225755 ATCCTAGCACTTTGGGAGGGAGG - Intronic
1086336145 11:85802381-85802403 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1086376161 11:86202856-86202878 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1086399308 11:86447591-86447613 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1086657407 11:89376628-89376650 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1088238180 11:107747483-107747505 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1088362540 11:109006194-109006216 ATCCCAGCACTTTGGAAGGCCGG + Intergenic
1089516400 11:119034949-119034971 ATCCCAACACTTTGGAAGGATGG + Intergenic
1089666674 11:120025002-120025024 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1089857969 11:121563646-121563668 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1090039810 11:123280704-123280726 ATCCCAGCACTTTGGGTGAAGGG - Intergenic
1090479306 11:127054078-127054100 ATCCCAGCACTTTGGGTGGGTGG - Intergenic
1090585052 11:128202322-128202344 ATCTAAGCAGTGTGTATGGAGGG - Intergenic
1090751214 11:129748057-129748079 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
1091107322 11:132934885-132934907 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1091731901 12:2887223-2887245 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1092380101 12:7988870-7988892 ATCCCAGCACTTTGGAAGGCAGG - Intergenic
1092602259 12:10080054-10080076 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1092778970 12:11967823-11967845 CCCCAATCACTGTGGATGGAAGG - Intergenic
1093169455 12:15843479-15843501 ATCCCAGCACTTTGGAAGGCAGG + Intronic
1093239277 12:16649306-16649328 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
1093648792 12:21619631-21619653 ATCCCAGCACTTTGGAAGGCGGG + Intergenic
1093941620 12:25061270-25061292 ATCCCAGCACTGTGGGAGGCCGG + Intronic
1094142644 12:27196744-27196766 ATCCCAGCACTTTGGATTCAAGG + Intergenic
1095367700 12:41427835-41427857 ATCCTAGCAATTTGGAAGGCTGG + Intronic
1096205566 12:49718786-49718808 ATCCCAGCACTCTGGGAGGATGG + Intronic
1096299751 12:50416407-50416429 ATCCCAGCACTTGGGATGGGAGG + Intronic
1096332096 12:50722504-50722526 ATCCCAGCACTTTGGAAGGTTGG - Intronic
1096339942 12:50789509-50789531 ATCCTAGCACTTTGGGAGGCGGG + Intronic
1096403915 12:51329002-51329024 ATCCCAGCACTTTGGGTGGCAGG + Intronic
1096410074 12:51370790-51370812 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1096628729 12:52911778-52911800 ATCCCAGCACTTTGGGTGGGTGG + Intronic
1096642132 12:53003137-53003159 ATCCCAGCACTTTGGGTGGCTGG + Intergenic
1097138320 12:56878552-56878574 AACCAATCACTGTGCATGGAGGG + Intergenic
1097929434 12:65168222-65168244 ATCCTAGCACTTTGGGAGGCGGG - Intergenic
1098093194 12:66925894-66925916 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1098545480 12:71706760-71706782 ATCCTAGCACTTTGGAAGTCCGG + Intergenic
1099956837 12:89359416-89359438 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
1100601299 12:96113653-96113675 ATCCCAGCACTTTGGGAGGAAGG + Intergenic
1101347159 12:103896534-103896556 ATCCCAGCACTTTGGAAGGCAGG + Intergenic
1101538599 12:105643437-105643459 ATCCCAGCACTGTGGGAGGCAGG - Intergenic
1101684585 12:107006131-107006153 ATCCTAGCACTCTGGGAGGCTGG + Intronic
1102341901 12:112127953-112127975 ATCCCAGCACTCTGGAAGGCTGG - Intronic
1102566406 12:113800214-113800236 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1102878512 12:116466477-116466499 ATCCCAGCACTTTGGGAGGATGG - Intergenic
1102936492 12:116901620-116901642 ATCCTAGCACTTTGGGTGGATGG - Intergenic
1103694918 12:122807277-122807299 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1103769028 12:123305723-123305745 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1103796648 12:123507687-123507709 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1103849373 12:123921965-123921987 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1104996651 12:132662129-132662151 ATCCCAGCACCATGGCTGGATGG - Intronic
1105306774 13:19174384-19174406 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1105484958 13:20819407-20819429 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1106164729 13:27233740-27233762 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1106254049 13:28006004-28006026 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1106650098 13:31681236-31681258 ATACTATCACTGTGAAGGGAGGG + Intergenic
1106696627 13:32181140-32181162 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1106783369 13:33082771-33082793 ATCCCAGCACTGTGGGAGGCCGG + Intergenic
1107518526 13:41155972-41155994 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1107873983 13:44772835-44772857 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1108256901 13:48619665-48619687 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1108672748 13:52708431-52708453 ATCCTAGCACTTTGGGAGGCAGG - Intronic
1109672630 13:65629347-65629369 ATCCTAGCACTTTGGGAGGCGGG + Intergenic
1110131373 13:72015745-72015767 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1110272275 13:73604323-73604345 ATCCTCGCACTGTGAAAAGAAGG + Intergenic
1110561232 13:76912582-76912604 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1111193121 13:84835137-84835159 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1111734508 13:92120501-92120523 ATCCTAGCACTTTGAGTGGCAGG - Intronic
1111917993 13:94381794-94381816 TTCACAGCCCTGTGGATGGATGG - Intronic
1112013686 13:95313590-95313612 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1112099166 13:96168451-96168473 ATCCCAGCACTTTGGGTGGCCGG + Intronic
1112271343 13:97973292-97973314 ATCCTAGCACTTTGGGAGGCGGG - Intronic
1112873031 13:103998489-103998511 AACTTAGCACTGTAGGTGGATGG - Intergenic
1113084525 13:106554632-106554654 ATCCCAGCACTTTGGGAGGACGG + Intronic
1113591536 13:111504823-111504845 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1114835897 14:26202880-26202902 ATCCCAGCACTGTGGGAGGACGG + Intergenic
1115263048 14:31473008-31473030 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1115552897 14:34520460-34520482 ATCCTAGCACTTTGGGAGGCAGG - Intronic
1115570516 14:34662105-34662127 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1115598640 14:34934207-34934229 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1115859801 14:37671678-37671700 ATCATATCACTGAGGAAGGATGG - Intronic
1116424080 14:44768050-44768072 ATCCCAGCACTTTGGAAGGCAGG + Intergenic
1116454949 14:45109081-45109103 ATCTTAGCACTGGGGGTAGAGGG - Intronic
1116970773 14:51062746-51062768 ATCCCTGAACTGTGGATGCATGG + Intronic
1117084990 14:52191037-52191059 ATCCCAGCACTTTGGGAGGAGGG + Intergenic
1117462959 14:55964387-55964409 AACCTAGAACTGTGAAGGGAAGG + Intergenic
1117735518 14:58765018-58765040 ATCCCAGCACTTTGGAAGGCAGG - Intergenic
1117998638 14:61502311-61502333 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1118076051 14:62300312-62300334 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1118196951 14:63635952-63635974 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1118274741 14:64375739-64375761 ATCCCAGCACTTTGGATATACGG - Intergenic
1118295966 14:64569989-64570011 ATCCTAGCACTTTGGGAGGTTGG - Intronic
1118625570 14:67655991-67656013 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1119197080 14:72724956-72724978 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1119349415 14:73951576-73951598 ATCCCAGCACTTTGGGAGGAAGG - Intronic
1119403564 14:74381094-74381116 ATCCCAGCACTTTGGGTGGCTGG - Intergenic
1119707613 14:76794417-76794439 ATCCCAGCACTTTGGAAGGCTGG + Intronic
1119836628 14:77755989-77756011 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1119837336 14:77762059-77762081 ATCCTAGCACTTTGGGAGGTCGG + Intronic
1119847549 14:77841570-77841592 ATCCCAGCACTTTGGTTGGGAGG + Intronic
1120208957 14:81615550-81615572 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1120443920 14:84569438-84569460 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1120782701 14:88500183-88500205 ATCCCAGCACTGTGGGAGGCAGG + Intronic
1120887816 14:89465472-89465494 ATCCCAGCACTTTGGGAGGAGGG - Intronic
1121135184 14:91491313-91491335 ATCCCAGCACTTTGGGAGGAGGG - Intronic
1121204758 14:92153944-92153966 ATCCTAGCACTTTGCAAGGCAGG - Intronic
1121635037 14:95448432-95448454 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1121654817 14:95587668-95587690 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
1121924602 14:97916154-97916176 ACCCAAGCACTGTGGATAGGTGG - Intergenic
1122432054 14:101658055-101658077 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1122486360 14:102084296-102084318 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1122625044 14:103080639-103080661 ATCATGGAAGTGTGGATGGATGG + Intergenic
1123688110 15:22814451-22814473 ATCCCAGCACTCTGGGAGGACGG - Intronic
1123694947 15:22872031-22872053 ATCCTAGCACTTTGGGAGGTGGG + Intronic
1125711754 15:41792601-41792623 TTCCTAGAGCTGTAGATGGATGG + Intronic
1125804052 15:42477502-42477524 ATCCCAGCACTTTGGGAGGATGG + Intronic
1125937126 15:43646967-43646989 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1125951719 15:43757990-43758012 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1126105713 15:45145661-45145683 ATCCTAGCACTTTGGGAGGCGGG + Intronic
1127402531 15:58604107-58604129 ATCCTAGCACTGTGGGAAGCCGG + Intronic
1127423226 15:58828805-58828827 ATCCCAGCACTTTGGAAGGCGGG - Intronic
1128261845 15:66238168-66238190 CTCCTAGCAGTGGGGATGCAGGG - Intronic
1128367542 15:67015102-67015124 ATCCTAGCACTTTGGGAGGTGGG - Intergenic
1128435745 15:67645807-67645829 ATCCCAGCACTCTGGAAGGGAGG - Intronic
1128502523 15:68237226-68237248 ATCCTAGCACTTTGGGAGGCAGG + Intronic
1128821528 15:70660214-70660236 ATCCTAGAAATGTGGAAAGATGG + Exonic
1128832232 15:70780009-70780031 ATCCTAGCACTTTGGGAGGCGGG + Intergenic
1129080662 15:73037088-73037110 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1129347824 15:74935376-74935398 ATCCCAGCACTTTGGAAGGTGGG + Intronic
1129984128 15:79901937-79901959 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1130877335 15:88026017-88026039 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1131018401 15:89076734-89076756 ATCCTAGCACTTTGGAAGGCTGG - Intergenic
1131729913 15:95268621-95268643 ATCCCAGCACTTTGGAAGGCAGG - Intergenic
1132809819 16:1792170-1792192 ACCCAAGCCCTGTGGCTGGACGG - Exonic
1132910132 16:2305675-2305697 ATCCCAGCACTTTGGGAGGACGG - Intronic
1133014171 16:2931369-2931391 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1133112845 16:3559444-3559466 ATCCTAGCAATCTGGAAGGTGGG - Intronic
1133190586 16:4130882-4130904 TTTCTAACACTGTGGATGGTGGG + Intergenic
1133749248 16:8711985-8712007 ATCCTAGCACTTTGGGAGGTCGG + Intronic
1134249776 16:12566189-12566211 ATCCTAGTACTGTGGTGGTAAGG - Intronic
1134464630 16:14464093-14464115 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1135056854 16:19239023-19239045 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1135123260 16:19785019-19785041 ATCCCAGCACTTTGGAAGGCCGG - Intronic
1135612281 16:23878921-23878943 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1135739471 16:24961114-24961136 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1135963551 16:27017437-27017459 ATCCCAGCACTTAGGAAGGATGG - Intergenic
1136224300 16:28848184-28848206 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1136649004 16:31649577-31649599 ATCCTAGCACTTTGGGAGGATGG + Intergenic
1137348726 16:47690965-47690987 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1137590983 16:49693605-49693627 AGCCAATCACTGTGGCTGGAGGG - Intronic
1138121337 16:54403029-54403051 GTCCTTGCTCTGTGGATTGAAGG - Intergenic
1138667269 16:58582029-58582051 ATCACAGCACTTTGGAAGGAGGG + Intronic
1138704286 16:58898407-58898429 ATCCTAGCACTCTGGGAGGCCGG - Intergenic
1139223657 16:65212520-65212542 TTTCTTGCACTGAGGATGGAAGG - Intergenic
1139828896 16:69780749-69780771 ATCCCAGCACTTTGGAAGGTGGG + Intronic
1140074400 16:71684042-71684064 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1140347445 16:74227915-74227937 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1140374454 16:74433687-74433709 ATCCTAGCACTTTGGGAGGATGG - Intergenic
1140389718 16:74574986-74575008 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1140463744 16:75162372-75162394 ATCCTAGCACTTTGGAGCCAAGG - Intronic
1141024509 16:80532593-80532615 ATACTATCACAGAGGATGGAGGG + Intergenic
1141217891 16:82042299-82042321 ATCCTAGCACTGTGGGAGGCTGG - Intronic
1142326024 16:89415204-89415226 ATCCCAGCACTTTGGGAGGAAGG - Intronic
1142587858 17:985673-985695 ATCCCAGCACTGTGGGAGGCCGG - Intergenic
1142616007 17:1135621-1135643 ATCCCAGCACTGTGGGAGGCTGG + Intronic
1142689451 17:1596369-1596391 ATCCCAGCACTTTGGAAGGCTGG + Intronic
1142800122 17:2339470-2339492 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1143865377 17:9919214-9919236 ATCCTTGCAAAGTGGATGGATGG - Intronic
1144106389 17:11990115-11990137 TTCCTAGCTCTGTGGGTGTATGG - Intronic
1144497930 17:15761112-15761134 ATCCCAGCACTTTGGGAGGAGGG - Intergenic
1144549913 17:16231153-16231175 CTCCTAGCACTTTGGAAGGCGGG - Intronic
1144746389 17:17617979-17618001 ATCCTAGCACTTTGGAAAGGAGG + Intergenic
1144967688 17:19088543-19088565 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
1144980228 17:19163520-19163542 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1144987994 17:19214712-19214734 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
1145011136 17:19368690-19368712 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1145161307 17:20576165-20576187 ATCCCAGCACTTTGGGAGGAGGG - Intergenic
1145234477 17:21199067-21199089 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1145360528 17:22208331-22208353 ATCCCAGCACTTTGGGAGGACGG + Intergenic
1146258198 17:31403984-31404006 ATCCCAGCACTGGGCAGGGAGGG + Intronic
1146267717 17:31464064-31464086 ATCCTAGCACTTTGGGAGAATGG - Intronic
1146292556 17:31620693-31620715 ATCCCAGCACTTTGGAAGGCGGG - Intergenic
1146560410 17:33864157-33864179 ATCCCAGCACTTTGGGTGGGGGG - Intronic
1146796723 17:35786614-35786636 ATCCTAGCACTTTGGAAGGCTGG + Intronic
1147026185 17:37586244-37586266 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1147282056 17:39370236-39370258 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1147603562 17:41760811-41760833 ATCCCAGCACTTTGGGAGGACGG - Intronic
1147793353 17:43026395-43026417 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1148012134 17:44491599-44491621 ATCCTAGCACTTTGGAAGGCAGG + Intronic
1148048092 17:44756335-44756357 ATCCTAGCACTTTGGGAGGCAGG + Intergenic
1148320754 17:46750098-46750120 ATCCCAGCACTTTGGGAGGACGG + Intronic
1148427930 17:47616302-47616324 ATCCCAGCACTTTGGATGGGAGG + Intronic
1148928937 17:51112418-51112440 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1149594298 17:57855094-57855116 ATCCCAGCACTTTGGAAGGCCGG + Intergenic
1149721931 17:58853573-58853595 ATCCCAGCACTGTGGGAGGCTGG + Intronic
1150075380 17:62187612-62187634 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
1150091747 17:62332517-62332539 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1150441889 17:65197921-65197943 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1150635177 17:66907993-66908015 ATCCTAGCACTTTGGGTGGCAGG - Intergenic
1150686035 17:67321677-67321699 ATCCTAGCACTTTGGGAGGCAGG + Intergenic
1150893482 17:69182806-69182828 ATCCTAACATAGTGGAAGGAAGG + Exonic
1151128763 17:71873933-71873955 ATCCTCACATTGTGGAAGGAAGG + Intergenic
1151229917 17:72677178-72677200 ATCCTAGCACTGTGGATGGAAGG + Intronic
1151482580 17:74379127-74379149 ACCCTAGCACTTTGGAGGCAAGG + Intergenic
1151603177 17:75119054-75119076 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1151700496 17:75740264-75740286 ATCCTAGCATGGTTGCTGGAGGG + Intronic
1151707955 17:75781377-75781399 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1151754765 17:76067716-76067738 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1151896016 17:76981482-76981504 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1152560676 17:81077312-81077334 ATCCCAGCACTTTGGGAGGACGG + Intronic
1152565936 17:81100498-81100520 ACCCCAGGACTGTGGATAGAGGG - Intronic
1152839949 17:82561001-82561023 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1153243879 18:3054871-3054893 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1153484611 18:5584052-5584074 ATCCTAGCACTTTGGGAGGCAGG - Intronic
1153837346 18:8975938-8975960 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1153892052 18:9526444-9526466 ATCCTAGCACTTTGGGGGGTGGG - Intronic
1154239925 18:12643934-12643956 ATCCCAGCACTTTGGAAGGCTGG + Intronic
1154942688 18:21130558-21130580 ATCCTAGCACTTTGGAATGCTGG - Intergenic
1154970648 18:21405546-21405568 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1154984956 18:21541346-21541368 ATCCCAGCACTTTGGGAGGAGGG + Intronic
1155038759 18:22047216-22047238 ATCCTAGCACTTTGGGAGGTGGG + Intergenic
1155387152 18:25290804-25290826 ATCCCAGCACTTTGGGTGGCTGG - Intronic
1156802685 18:41136922-41136944 ATCTTAACACTGTTGATGTATGG + Intergenic
1157244110 18:46038558-46038580 GTCCTAGCACTGTTGAAGGAAGG + Intronic
1157249689 18:46083725-46083747 ATCCCAGCACTGTGGTAGGTAGG + Exonic
1157638917 18:49192172-49192194 ATCCCAGCACTCTGGGTGGAAGG - Intronic
1157869390 18:51215983-51216005 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1158849558 18:61481800-61481822 ATCCTAGCACTTTGGAAGGCTGG - Intronic
1158849667 18:61482747-61482769 ATCTTAGCACTTTGGAAGGCTGG - Intronic
1160176720 18:76600882-76600904 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1160273107 18:77405433-77405455 ATCCCAGCACTTTGGAGGGCCGG - Intergenic
1160595672 18:79972404-79972426 ATCCTAGCAGTGTGGATGGTTGG - Exonic
1160862460 19:1243410-1243432 ATCCTAGCACTTTGGAAGGCCGG + Intronic
1161148026 19:2691289-2691311 ATCCCAGCACTTTGGGAGGACGG + Intronic
1161284331 19:3461191-3461213 ATCCTAGCACTTTGGGAGGAAGG + Intronic
1161367663 19:3890188-3890210 ATCCTAGCACTTTGGGAGGTGGG - Intronic
1161391178 19:4021395-4021417 ATCCCAGCACTGTGGAGGCGAGG - Intronic
1161717332 19:5883769-5883791 ATCCTAGCACTTTGGGAGGCAGG + Intronic
1161755329 19:6129260-6129282 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1161954264 19:7484101-7484123 ATCCTAGCACTTTGGGAGGCGGG + Intronic
1162058312 19:8079018-8079040 ATCCCAGCACTTTGGGAGGATGG - Intronic
1162405855 19:10473234-10473256 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1162437714 19:10672304-10672326 ATCCCAGCACTGTGGGAGGCTGG - Intronic
1162503346 19:11067257-11067279 ATCCCAGCACTTTGGGAGGATGG - Intergenic
1162638217 19:11987005-11987027 ATCCTAGCACTGTGGGAGGCTGG + Intergenic
1162880847 19:13658084-13658106 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1163272585 19:16263050-16263072 ATCCCAGCACTTTGGGAGGACGG + Intergenic
1163407899 19:17135014-17135036 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1163468181 19:17481757-17481779 ATCCCAGCACTTTGGAAGGAAGG - Intronic
1163566592 19:18055446-18055468 ATCCCAGCACTTTGGGAGGACGG + Intergenic
1164020514 19:21300057-21300079 ATCCAAGCACTTTGGGAGGAAGG + Intronic
1164090114 19:21942899-21942921 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1164872810 19:31660451-31660473 ATCCTAGCACAGAGGAAGGGAGG + Intergenic
1165222497 19:34328281-34328303 ATCCTAGCACTTTGGGAGGCGGG + Intronic
1165302664 19:34980873-34980895 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1165482955 19:36076303-36076325 ATCCCAGCACTTTGGAAGGCTGG + Intronic
1165484746 19:36088933-36088955 ATCCCAGCACAGTTGATTGATGG + Intronic
1165588641 19:36945839-36945861 ATCCCAGCACTTTGGAAGGCTGG + Intronic
1165736303 19:38178248-38178270 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1165754647 19:38285589-38285611 ATCCTAGCACTTTGGGAGGCAGG - Intronic
1165908283 19:39207176-39207198 ATCCCAGCACTGTGGGAGGCAGG - Intergenic
1166533893 19:43559825-43559847 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1166538604 19:43591593-43591615 ATCCTAGCACTTTGGGAGGCCGG + Exonic
1166612429 19:44210939-44210961 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1166688000 19:44807616-44807638 ATCCCAGCACTTTGGAAGGCAGG + Intergenic
1166763031 19:45236217-45236239 CTCCTAGCACTTTGGAAGGTGGG + Intronic
1166970110 19:46560819-46560841 ATCCTAACACTTTGGAAGGCAGG + Intronic
1166993675 19:46708561-46708583 ATCCCAGCACTTTGGGAGGATGG - Intronic
1167018179 19:46855488-46855510 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1167073472 19:47234353-47234375 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1167123936 19:47536488-47536510 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1167386108 19:49164993-49165015 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1167461601 19:49627550-49627572 ATCCCAGCACTGTGGGAGGCCGG + Intergenic
1167487440 19:49771101-49771123 ATCCTAGCACTTTGGAAGGCTGG - Intronic
1167770192 19:51510067-51510089 TTCTGAGCTCTGTGGATGGAGGG - Intergenic
1167851876 19:52208419-52208441 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1167993012 19:53376715-53376737 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1168149820 19:54439769-54439791 ATCCCAGCACTGTGGGAGGCTGG + Intergenic
1168213921 19:54911497-54911519 ATCCCAGCACTTTGGAAGGCAGG + Intronic
1168256704 19:55170150-55170172 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
1168428176 19:56256448-56256470 ATCCCAGCACTTTGGTTGGGAGG - Intronic
925270533 2:2603719-2603741 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
927594446 2:24384473-24384495 ATCCCAGCACTTTGGAAGGCGGG - Intergenic
928033941 2:27804380-27804402 TTCCTAGGCCTGTGGATGGTTGG - Intronic
928515538 2:32041413-32041435 ATCCTAGCACTTTGGAAGGCCGG - Intergenic
929102606 2:38331048-38331070 ATCCTAGCACTTTGGGAGGCAGG + Intronic
929118381 2:38464156-38464178 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
929141388 2:38669630-38669652 ATCCCAGCACTCTGGGTGGGTGG + Intronic
929167659 2:38899934-38899956 ATCCTAGCACTTTGGAAGGCTGG + Intronic
929502988 2:42506015-42506037 ATCCTAGCACTTTGGGAGGCCGG - Intronic
929570121 2:43017538-43017560 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
929763895 2:44828386-44828408 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
930058333 2:47269080-47269102 ATCCTAGCACTTTGGAGGCCAGG + Intergenic
930637772 2:53824603-53824625 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
930645769 2:53905280-53905302 ATCCCAACACTGTGGGTGGGAGG - Intronic
930817602 2:55615607-55615629 ATCCTAGCACTTTGGGAGGCGGG + Intronic
931270468 2:60697417-60697439 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
931349659 2:61475887-61475909 ATCCTAGCACTTTGGCAGGTGGG - Intergenic
932051680 2:68404524-68404546 ATCCTAGTACTATGTATGGGAGG - Intergenic
932198100 2:69801654-69801676 ATCCTAGCACTTTGGGAGGCTGG - Intronic
932618916 2:73254518-73254540 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
933711790 2:85332047-85332069 ATCCCAGCACTTTGGTTGGGAGG + Intergenic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
933912490 2:86955250-86955272 ATCCTAGCACTTTGGGAGGCTGG - Intronic
934010505 2:87814645-87814667 ATCCTAGCACTTTGGGAGGCTGG + Intronic
934112819 2:88758147-88758169 ATCCCAGCACTTTGGATGGGAGG - Intergenic
934547231 2:95227855-95227877 ATCCCAGCACTTTGGCAGGATGG - Intronic
935170704 2:100609496-100609518 ATCCTAGCACTTTGGCAGGCTGG + Intergenic
935774076 2:106455350-106455372 ATCCTAGCACTTTGGGAGGCTGG + Intronic
935905990 2:107840563-107840585 ATCCTAGCACTTTGGGAGGCTGG - Intronic
935992462 2:108733074-108733096 ATCCTAGCACTTTGGGAGGCTGG - Intronic
936127776 2:109805710-109805732 ATCCTAGCACTTTGGGAGGCTGG - Intronic
936216921 2:110565775-110565797 ATCCTAGCACTTTGGGAGGCTGG + Intronic
936410724 2:112255532-112255554 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
936426059 2:112420359-112420381 ATCCTAGCACTTTGGGAGGCTGG + Intronic
936474612 2:112829194-112829216 ATCCCAGCACTTTGGGTGGCAGG - Intergenic
937776936 2:125788989-125789011 ATCCTAGCACTTTGGGAGGCAGG + Intergenic
938325012 2:130392502-130392524 ATCCTAGCACTTTGGAAGGCAGG + Intergenic
938393197 2:130921247-130921269 ATCCTAGCACTTTGGGAGGCAGG + Intronic
938629794 2:133154092-133154114 ATCCTAGCACTTTGGGAGGCCGG - Intronic
938771673 2:134506261-134506283 CTCCCAGCAGTGTGGAAGGAGGG - Intronic
939815413 2:146890194-146890216 ATCATAGCATGGGGGATGGAGGG - Intergenic
940038253 2:149331283-149331305 ATCCCAACTCTGTGGGTGGATGG - Intronic
940474407 2:154143602-154143624 ATCCCAGCACTTTGGGTGGGAGG + Intronic
941058281 2:160813851-160813873 ATCCTTGCAGTGTGTCTGGATGG + Intergenic
941879725 2:170468906-170468928 ATCCTAGCACTTTGGGAGGCAGG + Intronic
941936434 2:170984914-170984936 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
942179014 2:173362067-173362089 ATCCCAGCACTTTGGAAGGCCGG - Intronic
942237414 2:173925148-173925170 ATCCCAGCACTTTGGGTGGGCGG - Intronic
942569471 2:177298721-177298743 ATCCCAGCACTTTGGAAGGCTGG + Intronic
943118464 2:183704899-183704921 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
943571250 2:189577861-189577883 ATCCTAGCACTTTGGGAGGCAGG - Intronic
943595033 2:189845974-189845996 ATCCTAGCACTTTGGGAGGCCGG - Intronic
944050321 2:195460364-195460386 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
944704014 2:202270835-202270857 ATCCCAGCACTTTGGAAGGCTGG + Intronic
944846214 2:203670769-203670791 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
945277621 2:208004164-208004186 ATCCCAGCACTGTGGGAGGCAGG + Intronic
945773328 2:214073485-214073507 ATCCCAGCACTTTGGAAGGCCGG - Intronic
945802637 2:214452090-214452112 TTCCTAGCACTCTGTATGCATGG + Intronic
946706199 2:222461006-222461028 ATCCCAGCACTTTGGAAGGCAGG - Intronic
946863333 2:224020904-224020926 ATTTTAGCACTATGAATGGATGG + Intronic
946903745 2:224396465-224396487 ATCCTGGCCATGTGGAGGGATGG + Intronic
947089452 2:226493797-226493819 ATTATAGCACTGTGAAGGGAAGG + Intergenic
947631838 2:231658582-231658604 ATCCCAGCACTTTGGGAGGACGG + Intergenic
948617368 2:239209131-239209153 ATCCTAGCACTTTGGGAGGCTGG - Intronic
949013687 2:241697181-241697203 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1168759415 20:339224-339246 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1169006417 20:2210828-2210850 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1169184463 20:3602709-3602731 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1169248683 20:4044133-4044155 ATCCCAGCTCTGTGAAAGGAAGG - Intergenic
1169260283 20:4133408-4133430 ATCCTAGCACTTTGGGAGGCAGG + Intronic
1169314223 20:4574858-4574880 ATCCCAGCACTTTGGAAGGCAGG + Intergenic
1170316889 20:15052001-15052023 ATCCCAGCACTTTGGAAGGCCGG - Intronic
1170623854 20:18015986-18016008 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1170709041 20:18773772-18773794 ATCCTAGCACTTTGGGAGGGTGG + Intergenic
1171292102 20:23988296-23988318 ATCCTAGCACTTTGGGAGGTCGG - Intronic
1171795544 20:29563487-29563509 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1171852882 20:30320952-30320974 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
1172433123 20:34909091-34909113 ATCCCAACACTTTGGAAGGAAGG + Intronic
1172439861 20:34957740-34957762 ATCCTAGCACTCTGGGAGGCTGG - Intergenic
1172894340 20:38289079-38289101 ATCCCAGCACTTTGGGAGGATGG - Intronic
1173332405 20:42086189-42086211 ATCCTAGCACTCTGGGAGGCTGG - Intronic
1173957801 20:47047928-47047950 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1173973232 20:47168439-47168461 ATCCTAGCACTGTGGGAGACAGG - Intronic
1174394461 20:50238077-50238099 ATCCCAGCACTTTGGTTGGGAGG - Intergenic
1174623374 20:51894343-51894365 ATCCCAGCACTCAGGAAGGACGG - Intergenic
1174797927 20:53538072-53538094 ATCCTAGCACTTTGGGAGGTTGG + Intergenic
1175072325 20:56344939-56344961 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
1175153264 20:56952042-56952064 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1175218467 20:57403870-57403892 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1175603603 20:60295017-60295039 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1175865135 20:62171764-62171786 ATCCCAGCACTTTGGAAGGCAGG + Intronic
1176384251 21:6129558-6129580 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1177654459 21:23999785-23999807 ATCCCAGCACTTTGGGTGGGAGG + Intergenic
1178339033 21:31770040-31770062 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1178426839 21:32485413-32485435 ATCCCAGCACTTTGGAAGGCGGG - Intronic
1178818165 21:35950545-35950567 ATCTAAGCACTGTGCAGGGAAGG + Intronic
1178869099 21:36357500-36357522 ATCCCAGCACTTTGGGTGGGAGG - Intronic
1179263668 21:39782447-39782469 AACCTAGATCTGTAGATGGATGG - Intronic
1179739221 21:43408686-43408708 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1179934996 21:44597682-44597704 ATCCCAGCACTGTGGGAGGCTGG - Intronic
1180147818 21:45931001-45931023 ATGCTGCCACTGTGGCTGGATGG + Intronic
1180781081 22:18520065-18520087 ATCCTAGCACTCTGGGAGGCAGG + Intergenic
1180791982 22:18579972-18579994 ATCCCAGCACTTTGGAAGGCAGG - Intergenic
1180823166 22:18846052-18846074 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
1181123591 22:20689151-20689173 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
1181189578 22:21128494-21128516 ATCCTAGCACTTTGGGAGGTCGG + Intergenic
1181209622 22:21282001-21282023 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
1181229752 22:21415337-21415359 ATCCCAGCACTTTGGAAGGCAGG + Intergenic
1181237968 22:21459414-21459436 ATCCTAGCACTCTGGGAGGCAGG + Intergenic
1181248897 22:21519529-21519551 ATCCCAGCACTTTGGAAGGCAGG - Intergenic
1181383911 22:22529292-22529314 AACCCAGCACTGTGGAAGGTGGG - Intergenic
1181649520 22:24251125-24251147 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
1181707851 22:24659621-24659643 ATCCTAGCACTTTGGGAGGTCGG + Intergenic
1181739611 22:24910399-24910421 ATCCTAGCACTTTGGGAGGCAGG + Intronic
1181878596 22:25959526-25959548 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1182326322 22:29515893-29515915 ATCCCAGCACTTTGGAAGAAAGG + Intronic
1182564763 22:31189547-31189569 ATCCTAGCACTTTGGGAGGTCGG - Intronic
1182590809 22:31378164-31378186 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1183129310 22:35818529-35818551 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1183848017 22:40559032-40559054 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1183948150 22:41338429-41338451 ATCCCAGCCCTGTAGATGGGAGG + Intronic
1183954831 22:41373199-41373221 GTCCTAGCACTGTGCCTGAATGG + Intronic
1184031206 22:41895885-41895907 ATCCCAGCACTTTGGGTGGGAGG + Intronic
1184203298 22:42984222-42984244 ATCCCAGCACTGTGGGAGGCTGG - Intronic
1184478111 22:44732237-44732259 CTCCTTGCCCTGTGGACGGAAGG - Exonic
1184495434 22:44838524-44838546 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1184883572 22:47328087-47328109 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1185379297 22:50500356-50500378 ATCCCAGCACTTTGGCAGGATGG + Intergenic
1185387499 22:50542121-50542143 ATCCCAGCACTTTGGGTGGGAGG - Intergenic
1203217325 22_KI270731v1_random:13432-13454 ATCCTAGCACTTTGGGAGGTCGG + Intergenic
1203273304 22_KI270734v1_random:71958-71980 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
949351774 3:3130782-3130804 ATCCTAGCACTTTGGGAGGCTGG + Intronic
949418738 3:3841768-3841790 ATCCCAGCACTGTGGGAGGCTGG - Intronic
949677363 3:6471076-6471098 ATCCTAGCACTGTGGGAGGCCGG - Intergenic
950021206 3:9789086-9789108 ATCCTAGCACTTTGGGAGGCCGG - Intronic
950313458 3:11979266-11979288 ATCCCAGCACTTTGGGAGGAGGG + Intergenic
950489577 3:13295519-13295541 ATCCTAGCACTTTGGAAGGTGGG - Intergenic
950520896 3:13497128-13497150 ATCCTAGCACTATGGCTTTAAGG + Intronic
950597792 3:14000113-14000135 ATCCCAGCACTTTGGAAGGCTGG - Intronic
950728504 3:14935554-14935576 ATCCCAGCACTTTGGAAGGTTGG + Intergenic
950829666 3:15860395-15860417 ATGCTGGCACTCTGGACGGAAGG + Intergenic
950908217 3:16558403-16558425 ATCCCAGCACTTTGGAAGGCGGG + Intergenic
951021297 3:17783371-17783393 ATCCCAGCACTTTGGGAGGATGG - Intronic
951538030 3:23757329-23757351 ATCCCAGCACTTTGGGTGGCCGG - Intergenic
951819762 3:26795068-26795090 ATCCTTGCCCTGTGGTTGGGAGG + Intergenic
952306926 3:32154999-32155021 ATCCTAGCACTTTGGGAGGCTGG - Intronic
952787077 3:37166083-37166105 ATCCCAGCACTTTGGAAGGCAGG + Intronic
953372040 3:42397278-42397300 ACCCTGGCACGGTGGCTGGATGG - Exonic
953536628 3:43782003-43782025 ATCCTCACACAGTGGATGGGAGG - Intergenic
953997177 3:47528943-47528965 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
954051685 3:47984577-47984599 ATCCTAGCACTTTGGGAGGGTGG + Intronic
954198452 3:49009972-49009994 ATCCCAGCACTTTGGAAGGCAGG - Intronic
954208860 3:49082187-49082209 ATCCTAGCACTTTGGGAGGTTGG - Intronic
954448955 3:50561471-50561493 ATCCTGGGACTGGGGATGGCAGG - Intronic
954462837 3:50637391-50637413 ATCCCAGCACTTTGGGTGGGTGG + Intronic
955082343 3:55669651-55669673 TTATTGGCACTGTGGATGGAGGG + Intronic
955236005 3:57139767-57139789 ATCCTAGCACTTTTGGAGGAAGG - Intronic
955388551 3:58500376-58500398 ATCCTAGCACTTTGGGAGGCCGG - Intronic
955501903 3:59593730-59593752 CTCTTAGGACTGTGGATGGAGGG + Intergenic
955598794 3:60621929-60621951 ATACTAGCTGTGTGGATGAAAGG - Intronic
955736824 3:62047512-62047534 ATCCTAGCACTTTGGGAGGCTGG - Intronic
955915285 3:63901687-63901709 ATCCAAGCACTCTGGAGGGAAGG - Intronic
956122054 3:65976374-65976396 ATCCCAGCACTGTGGGGAGACGG + Intronic
956643802 3:71437158-71437180 ATCCAAGCACTCTGGAAGGCAGG + Intronic
956833516 3:73076468-73076490 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
957029872 3:75227997-75228019 ATCCCAGCACTTTGGAAGGCGGG - Intergenic
958156986 3:89768077-89768099 ATCCTAGCACTTTGAGAGGACGG - Intergenic
959156330 3:102670707-102670729 ATCGTAGCACTGGGGAAGCAAGG + Intergenic
960634763 3:119773606-119773628 ATCCTAGCACTTTGTAGGGGTGG + Intergenic
961183212 3:124892430-124892452 ATCCCAGCACTTTGGGAGGAAGG + Intronic
961684268 3:128618474-128618496 ATCCAAGGACAGTGGAAGGATGG - Intergenic
961775948 3:129285697-129285719 ATCCTAGCACTTTGGGAGGCAGG - Intronic
962218405 3:133542513-133542535 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
962567061 3:136671642-136671664 ATCCCAGCACTGTGGGAGGTAGG + Intronic
962817144 3:139011493-139011515 ATCCTAGCACTTTGGGAGGCTGG + Intronic
963165154 3:142194130-142194152 ATCCCAGCACTTTGGAAGGCTGG + Intronic
963198265 3:142558268-142558290 ATCCTAGCACTTTAGAAGGCTGG + Intronic
963217896 3:142771424-142771446 ATCCTAGCACTTTGGAAGGCTGG - Intronic
964205324 3:154168322-154168344 ATCCCAGCACTTTGGAAGGTGGG + Intronic
964998951 3:162927233-162927255 ATCCTAGCACTTTGGCAGGCAGG + Intergenic
965593626 3:170386046-170386068 ATCCCAGCACTTTGGTTGGGAGG - Intronic
966052678 3:175639897-175639919 ATCCTCACTCTGTGGAAGGAAGG + Intronic
966101854 3:176278755-176278777 ATCCCAGCACTTTGGAAGGGCGG - Intergenic
966368101 3:179212691-179212713 ATCCTAGCACTTTGGGAGGTAGG - Intronic
966469826 3:180276557-180276579 ATCCTAGCACTTTGGAGGCCAGG + Intergenic
966776811 3:183549820-183549842 ATCCTAGCACTTTGGGAGGCCGG + Intronic
967247824 3:187505759-187505781 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
968029811 3:195474078-195474100 ATCCCAGCACTTTGGAAGGCGGG - Intergenic
968169043 3:196493772-196493794 ATCCTGGCACTTTGGAAGGCAGG - Intronic
968216565 3:196896697-196896719 ATCCCAGCACTTTGGAAGGCGGG - Intronic
968419899 4:474934-474956 ATCCTAGCACTTTGGGAGGCCGG + Intronic
968473647 4:792796-792818 ACCCCAGCACACTGGATGGAGGG - Intronic
969520310 4:7674325-7674347 ATCCCAGCACTTTGGGAGGAAGG + Intronic
970117381 4:12712363-12712385 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
970309483 4:14767058-14767080 ATCATAGCAGTGTGGCTTGAAGG + Intergenic
970938742 4:21606301-21606323 AACATATCACTGAGGATGGATGG + Intronic
970971211 4:21986415-21986437 TTCCAAGTATTGTGGATGGATGG - Intergenic
971337291 4:25735295-25735317 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
971527214 4:27635733-27635755 ATCCCAGCACTCTGGGTGGCCGG - Intergenic
972151440 4:36096109-36096131 ATCCCAGCACTTTGGGAGGATGG + Intronic
972393623 4:38636675-38636697 ATGCTGGCACTGTGGCTTGATGG - Intergenic
973643147 4:52923222-52923244 ATCCCAGCACTTTGGAAGGCAGG + Intronic
975646753 4:76553526-76553548 ATCCTAGCACTTTGGGAGGCCGG - Intronic
975700692 4:77063444-77063466 ATCCCAGCACTTTGGAAGGCCGG + Intronic
975932286 4:79539161-79539183 ATCCCAGCACTTTGGAAGGCGGG - Intergenic
975977981 4:80121013-80121035 ATCCCAGCACTTTGGGAGGAAGG + Intronic
976312760 4:83628674-83628696 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
978520727 4:109612516-109612538 ATCCTAGCACTTTGGGAGGCCGG - Intronic
978667807 4:111207326-111207348 ATCCTAGCACTTTGGAAGGCCGG + Intergenic
978792389 4:112676330-112676352 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
979251122 4:118567583-118567605 CTCCCAGCACTTTGGGTGGAAGG + Intergenic
979549995 4:121979752-121979774 ATCCCAGCACTTTGGGAGGATGG - Intergenic
980113787 4:128659829-128659851 ATTCTAATACTATGGATGGAAGG - Intergenic
980170467 4:129283621-129283643 TTCCTGGCACTGTGGATGAGGGG + Intergenic
980615504 4:135217639-135217661 AGTCTAGCCCTGTGGATGTATGG + Intergenic
980677647 4:136109788-136109810 ATCCTAGCACTTTGGAGGCGAGG - Intergenic
980767688 4:137329179-137329201 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
981272190 4:142857995-142858017 ATCCCAGCACTTTGGAAGGCCGG + Intergenic
981654364 4:147096352-147096374 ATCCTTGCACTGGGGAGGGGTGG - Intergenic
982003407 4:151042246-151042268 ATCCCAGCACTATGGAAGGCTGG + Intergenic
982183508 4:152772970-152772992 ATCCTAGCACTTTGGGAGGCTGG - Intronic
982471279 4:155793327-155793349 ATCCTAGCACTTTGGGAGGGTGG - Intronic
982945884 4:161621723-161621745 ATCCTAGCACTTTGGGAGGGAGG + Intronic
983230311 4:165123483-165123505 ATCCTAGCACTTTGGGAGGTTGG - Intronic
983604307 4:169568685-169568707 ATCCTAGCACTTTGGGAGGCCGG + Intronic
984568214 4:181356821-181356843 AGCCTGGCACTGTAGACGGATGG + Intergenic
984628805 4:182038983-182039005 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
984969759 4:185177580-185177602 ATCCCAGCACTCTGGAAGGCAGG + Intronic
985351123 4:189062290-189062312 ATCCCAGCAGTGTGGTGGGAAGG - Intergenic
986243974 5:5988469-5988491 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
986745964 5:10745368-10745390 ATCCTAGCAATTTGGCTGCAGGG + Intronic
986883973 5:12211612-12211634 ATCCTAGCACTTTGGGAGGCAGG + Intergenic
987708867 5:21484993-21485015 ATCCTAGCACTTTGGGAGGTCGG + Intergenic
987843039 5:23245367-23245389 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
987991346 5:25216713-25216735 ATCCCAGCACTTTGGAAGGTGGG + Intergenic
988099849 5:26661817-26661839 ATCCCAGCACTTTGGAAGGCCGG + Intergenic
988432626 5:31137294-31137316 ATCCTAGCACTCTGGGAGGCTGG - Intergenic
988468873 5:31517810-31517832 ATCCTAGCACTTTGGGAGGCCGG + Intronic
988750745 5:34189153-34189175 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
989753020 5:44918758-44918780 ATCCCAGCACTTTGGGAGGAAGG + Intergenic
989995097 5:50819695-50819717 ATCCTAGCACTTTGTTTGGGAGG - Intronic
990177487 5:53124192-53124214 ATCCCAGCACTGTGGGAGGCCGG + Intergenic
990355403 5:54961636-54961658 CTCCTAGATCTGAGGATGGAAGG + Intergenic
990823190 5:59866529-59866551 ATCCTAGCACTCCGGAAGGCTGG + Intronic
991063062 5:62399077-62399099 ATCCCAGCACTTTGGAAGGCTGG + Intronic
991677077 5:69098265-69098287 ATCCTAGCACTTTGTTTGGGAGG + Intronic
991735882 5:69631078-69631100 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
991739010 5:69652366-69652388 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
991759188 5:69904065-69904087 ATCCTAGCACTTTGGGAGGTCGG + Intergenic
991788148 5:70214057-70214079 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
991790585 5:70232107-70232129 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
991812376 5:70486717-70486739 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
991815335 5:70507194-70507216 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
991818471 5:70528483-70528505 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
991838417 5:70779131-70779153 ATCCTAGCACTTTGGGAGGTCGG + Intergenic
991880595 5:71214421-71214443 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
991883032 5:71232442-71232464 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
991991200 5:72341484-72341506 ATCCCAGCACTTTGGAAGGGGGG + Intronic
992085551 5:73275150-73275172 ATTCTAGCAATGTGGAGGGCAGG + Intergenic
992380863 5:76236315-76236337 ATCCCAGCACTCTGGGAGGAAGG + Intronic
992524652 5:77596860-77596882 ATCCTAGCACTTTGGGAGGGAGG + Intronic
992630102 5:78671514-78671536 ATCCTAGCACTTTGGGAGGCTGG - Intronic
992643123 5:78786857-78786879 ATCCCAGCACTTTGGAAGGCTGG - Intronic
992765435 5:79994559-79994581 ATCCTAGCACTTTGGGAGGGAGG + Intronic
993668439 5:90730107-90730129 ATCCCAGCACTTTGGGTGGGCGG - Intronic
993690285 5:90991529-90991551 ATCCTAGCACTTTGGGAGGTGGG - Intronic
994044772 5:95295562-95295584 ATCCTAGCACTTTGGTGGGCAGG - Intergenic
994420994 5:99526342-99526364 ATCCTAGCACTTTGGGAGGTCGG + Intergenic
994445276 5:99864307-99864329 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
995496210 5:112747079-112747101 ATCCAAGCACTTTGGAAGGCTGG - Intronic
995860922 5:116639609-116639631 CTCCTTCCACTGTGAATGGAGGG - Intergenic
996174134 5:120333666-120333688 TTCTTAGCACTGTGGAAGGTAGG + Intergenic
996429001 5:123349754-123349776 ATCCTAGCACTTTGAGAGGATGG - Intronic
997641515 5:135451734-135451756 ATCCCAGCACTTTGGAAGGTCGG - Intronic
997904835 5:137806291-137806313 ATCCCAGCACTTTGAATGGCAGG + Intergenic
998001155 5:138627083-138627105 ATCCTAGCACTTTGGGAGGCTGG - Intronic
998030604 5:138864202-138864224 ATCCCAGCACTCTGGAAGGCAGG - Intronic
998265632 5:140665607-140665629 ATCCCAGCACTCTGGGAGGAAGG - Intronic
998284682 5:140848553-140848575 ATCCTCGCAATGTGGGTGGTGGG + Exonic
998365000 5:141624281-141624303 ATCCCAGCACTTTGGAAGGCTGG + Intronic
998507467 5:142683572-142683594 ATCCTAGCACTTTGGGAGGCCGG + Intronic
998565371 5:143211805-143211827 ATCCTAGCACTTTGGGAGGTGGG - Intronic
998838531 5:146228532-146228554 ATCCCAGCACTTTGGGTGGCCGG - Intronic
998965887 5:147539816-147539838 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
999083044 5:148862274-148862296 ATCCCAGCACTTTGGGTGGGTGG + Intergenic
999217779 5:149950077-149950099 ATCCCAGCACTTTGGGTGGGTGG + Intergenic
999333746 5:150697167-150697189 ATCCTAGCACTTTGCAAGGCTGG + Intronic
999370963 5:151055058-151055080 CTCGTAGCACCTTGGATGGAAGG - Intronic
999753660 5:154648433-154648455 ATCCTAGCACTTTGGGAGGCGGG + Intergenic
999779298 5:154836148-154836170 ATCCCAGCACTTTGGGAGGATGG - Intronic
1000276794 5:159744616-159744638 ACCCTAGCACTATGGAAGGCCGG + Intergenic
1000316714 5:160099571-160099593 ATCCCAGCACTATGGAAGGCAGG - Intronic
1000453146 5:161415863-161415885 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1000461024 5:161518058-161518080 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1000632124 5:163602601-163602623 ATCCCAGCACTTTGTTTGGAAGG + Intergenic
1001628804 5:173159289-173159311 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1001731770 5:173965440-173965462 ATCCCAGCACTTTGGAAGGTGGG + Intergenic
1001952745 5:175827500-175827522 ATCCCAGCACTGTGGGAGGCCGG + Intronic
1002593697 5:180308002-180308024 ATCCCAGCACTTTGGAAGGCTGG + Intronic
1002825831 6:773474-773496 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1003135860 6:3434361-3434383 ATCCTAGCACTTTGGGAGGGCGG + Intronic
1003148429 6:3528302-3528324 ATCCCAGCACTTTGGGTGGCCGG - Intergenic
1003543736 6:7040917-7040939 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
1003927159 6:10887161-10887183 GCCCTAGCACTGTGGACAGAAGG - Intronic
1004235244 6:13869646-13869668 AAAATAGCTCTGTGGATGGATGG - Intergenic
1004378340 6:15110701-15110723 ATCCCAGCACTTTGGAAGGTTGG - Intergenic
1005548815 6:26895458-26895480 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
1005872555 6:29985767-29985789 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
1005976416 6:30803486-30803508 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1006089118 6:31617466-31617488 ATCCCAGCACTTTGGGAGGATGG + Intergenic
1006107566 6:31725577-31725599 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1006495669 6:34421444-34421466 ATCCCAGCACTTTGGTTGGAGGG - Intronic
1007569913 6:42882147-42882169 ATCCCAGCACTTTGGAAGGCCGG - Intronic
1007573475 6:42909874-42909896 ATCCTAGCACTTTGGGAGGTGGG - Intergenic
1007588943 6:43009812-43009834 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1007803986 6:44423679-44423701 ATGTAAGCACTGAGGATGGATGG + Intronic
1008045602 6:46848857-46848879 AACGTAGGACTGTGGAGGGAGGG - Intergenic
1009019568 6:57936570-57936592 ATCCTAGCACTTTGGGAGGTCGG - Intergenic
1009618699 6:66044230-66044252 ATCCCAGCACTTTGGGAGGATGG - Intergenic
1010867500 6:80996805-80996827 ACCCTAGCGCTTTTGATGGAAGG + Intergenic
1011083671 6:83515732-83515754 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1011440073 6:87378513-87378535 ATCCCAGCACTTTGGAAGGCTGG + Intronic
1011614849 6:89188274-89188296 ATCCCAGCACTGTGGGTGGCCGG - Intronic
1011912074 6:92452823-92452845 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
1012019472 6:93899384-93899406 ATCCTAGCACAGTTGTTGAAGGG - Intergenic
1012365089 6:98429286-98429308 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1012885578 6:104842351-104842373 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1012906847 6:105076975-105076997 ATCCCAGCACTTTGGGAGGAAGG + Intronic
1013631758 6:111992635-111992657 ATCCTAGCACTTTGGAAGGCAGG + Intergenic
1013725639 6:113092067-113092089 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1013791791 6:113845733-113845755 ATCCTAGCACTTTGGAAGGTCGG + Intergenic
1013814357 6:114080027-114080049 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1015341999 6:132111180-132111202 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
1015711943 6:136151687-136151709 ATCCTAGCACTTTGGGAGGCGGG + Intronic
1015790612 6:136960610-136960632 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1015971171 6:138743795-138743817 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1016090858 6:139977085-139977107 ATCATAGCACTTTGGGTGGCTGG - Intergenic
1016091132 6:139980658-139980680 ATCCCAGCACTTTGGGAGGATGG + Intergenic
1016918610 6:149268184-149268206 CCCTTAGCACTATGGATGGAGGG - Intronic
1017482331 6:154870241-154870263 ATCCTAGCACTCTGGGAGGCAGG - Intronic
1018248746 6:161847055-161847077 ATCCCAGCACTGTGGGAGGCCGG + Intronic
1018957408 6:168419548-168419570 GTCTTAACACTGAGGATGGAGGG - Intergenic
1019057722 6:169235272-169235294 ATCCCAGCACTGTGGGAGGCTGG - Intronic
1019665531 7:2250339-2250361 ATCCCAGCACTGTGGACTGTGGG + Intronic
1019753861 7:2753388-2753410 ATCCCAGCACTTTGGGAGGATGG - Intronic
1019859076 7:3640111-3640133 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1019975486 7:4578003-4578025 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1020185358 7:5954910-5954932 ATCCCAGCACTTTGGGTGGGAGG + Intronic
1020221884 7:6245069-6245091 ATCCCAGCACTTTGGAAGGCCGG - Intronic
1020238291 7:6373568-6373590 ATCCCAGCACTTTGGTTGGGCGG - Intergenic
1020273705 7:6612535-6612557 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1020297555 7:6769835-6769857 ATCCCAGCACTTTGGGTGGGAGG - Intronic
1020514580 7:9101378-9101400 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1020570119 7:9850447-9850469 ATCTTAGCACTTTGGTTGGCTGG + Intergenic
1021027239 7:15685557-15685579 ATCCCAGCGCTGGGGAGGGAGGG - Intronic
1021034050 7:15774823-15774845 AACATAGCACTGTTCATGGATGG + Intergenic
1021071529 7:16248086-16248108 ATCCCAGCACTTTGGAAGGCAGG + Intronic
1021125580 7:16848266-16848288 ATCCTAGCACTTTGGGAGGCAGG + Intergenic
1021338614 7:19435030-19435052 ATCCTAGCACTTTGGGAGGCGGG - Intergenic
1021694462 7:23262870-23262892 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1021733163 7:23617094-23617116 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1022178970 7:27899676-27899698 ATCCTAACACTTTGGGTGGGAGG - Intronic
1022421082 7:30224009-30224031 ATTCTATCACTGTGGAAGAAAGG - Intergenic
1022687064 7:32607011-32607033 ATCCTAGCACTTTGGGTGGGTGG + Intergenic
1023281430 7:38574801-38574823 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1023885597 7:44352125-44352147 ATCCCAGCACTTTGGAAGGCCGG + Intergenic
1023907903 7:44535120-44535142 ATCCCAGCACTTTGGGTGGGCGG + Intronic
1024469267 7:49750278-49750300 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1024690718 7:51799444-51799466 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1025243927 7:57301686-57301708 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1026078740 7:67198292-67198314 ATCCCAGCACTTTGGGAGGAAGG + Intronic
1026343307 7:69452616-69452638 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
1026630849 7:72037082-72037104 CTCCTAGCACTTTGGGAGGATGG - Intronic
1026698078 7:72613662-72613684 ATCCCAGCACTTTGGGAGGAAGG - Intronic
1026976219 7:74500324-74500346 ATCCTAGCACTTTGGGAGGGAGG + Intronic
1026977697 7:74508437-74508459 ATCCTAGCACTTTGGGAGGCCGG + Intronic
1027144069 7:75681751-75681773 ATCCTAGCACTTTGGGAGGTGGG - Intronic
1027312402 7:76962759-76962781 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1028190875 7:87850520-87850542 ATCCCAGCACTTTGGAAGGCAGG + Intronic
1028413657 7:90557812-90557834 GCCCTACCACTGTGTATGGATGG - Intronic
1028599268 7:92583794-92583816 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1028642167 7:93054586-93054608 ATCCCAGCACTTTGGGAGGATGG + Intergenic
1029159609 7:98542268-98542290 ATCCTAGCACTCTGGGAGGCTGG - Intergenic
1029214538 7:98936974-98936996 ATCCTAGCACTGGGGAGGCCAGG + Intronic
1029371105 7:100151327-100151349 ATCCCAGCACTTTGGGTGGGAGG - Intronic
1029838185 7:103335084-103335106 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1030300651 7:107970982-107971004 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1030471230 7:109964863-109964885 ATCCTAGCACTCTGGGAGGCTGG - Intergenic
1031327613 7:120421815-120421837 ATGCCAGGATTGTGGATGGAGGG - Intronic
1031623021 7:123958573-123958595 ATCCCAACACTGTGGAAGGATGG + Intronic
1031942758 7:127806701-127806723 ATCCCAGCACTTTGGGTGGGAGG + Intronic
1032234822 7:130111449-130111471 ATCCCAGCACTTTGGATGGCTGG + Intronic
1032727491 7:134604449-134604471 ATCCAAGCACTTTGGGTGGCTGG + Intergenic
1033325592 7:140375214-140375236 ATCCTAGCACCTTGGAAGGCGGG + Intronic
1033727234 7:144131834-144131856 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1034180580 7:149134341-149134363 ATCCTAGCACTTTGGGAGGCCGG - Intronic
1034189295 7:149201498-149201520 ATCCCAGCACTTTGGAAGGCCGG + Intronic
1034643459 7:152623723-152623745 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
1034761265 7:153674188-153674210 ATCCCAGCACTTTGGGTGGGTGG - Intergenic
1035835713 8:2749876-2749898 ATCCTAGCACAGTGGGTGTCCGG + Intergenic
1036041509 8:5087403-5087425 ATTCTAGGCCTGTTGATGGATGG + Intergenic
1036189692 8:6658966-6658988 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1036465908 8:8997082-8997104 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1036479890 8:9130283-9130305 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1037136766 8:15471868-15471890 ATCCTAGCACTTTGGGAGGCAGG - Intronic
1037237268 8:16735444-16735466 ATCCCAGCACTGTGGGAGGCCGG + Intergenic
1037471255 8:19213478-19213500 ATCCAAGCACTTTGGAAGGCAGG - Intergenic
1038144674 8:24884180-24884202 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1038235740 8:25752515-25752537 ATCCCAGCACTTTGGAAGGTTGG - Intergenic
1038245330 8:25849660-25849682 ATCATCTCATTGTGGATGGAGGG - Intronic
1038278382 8:26140808-26140830 ATCCTAGCACTTTGGAATGCTGG - Intergenic
1038294328 8:26277141-26277163 AGCCTAGCACTGTGGAAGGTGGG - Intergenic
1038301714 8:26356482-26356504 ATCACAGCACTATGGGTGGAGGG + Intronic
1038708595 8:29920401-29920423 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1038727414 8:30094208-30094230 ATTATAGGACTGGGGATGGAGGG + Intergenic
1039246425 8:35613603-35613625 ATCCCAGCACTTTGGGTGGGTGG + Intronic
1039534314 8:38294346-38294368 ATCCTAGCACTGTAGGAGGCTGG - Intronic
1039942968 8:42107149-42107171 ATCCCAGCACTTTGGGAGGATGG - Intergenic
1040010295 8:42656063-42656085 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
1040044746 8:42951312-42951334 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1040476532 8:47783023-47783045 ATCCCAGCACTTTGGAAGGATGG + Intronic
1042912026 8:73837690-73837712 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1043219071 8:77635985-77636007 ATCTTTGCACAGTGGTTGGATGG + Intergenic
1044357789 8:91244771-91244793 ATCCTAGCACTTTGGGAGGCAGG - Intronic
1044397866 8:91734865-91734887 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1044681772 8:94786375-94786397 ATCCTAGCACTTTGGGAGGCAGG - Intronic
1044987259 8:97766473-97766495 ATCCCAGCACTTTGGAAGGCCGG - Intergenic
1045007724 8:97930866-97930888 ATCCCAGCACTTTGGAAGGCGGG - Intronic
1045141945 8:99295774-99295796 ATCCCAGCACTTTGGAGGGGAGG + Intronic
1045381556 8:101632394-101632416 CTACTTGCCCTGTGGATGGATGG - Intronic
1045880913 8:107039522-107039544 ATCCTAGAACTGTGGAAGACAGG - Intergenic
1046934103 8:119869967-119869989 ATCCTAGCACTTTGGGAGGCTGG + Intergenic
1047157949 8:122342566-122342588 ATCCTAGCACTTTGGGAGGAGGG - Intergenic
1047273900 8:123390233-123390255 ATCCTAGCACTTTGTTTGGGAGG - Intronic
1047425002 8:124737075-124737097 ATCCTAGCACTTTGGGAGGCAGG - Intergenic
1047599227 8:126409597-126409619 ATCCCAGCACTTTGGAAGGAGGG - Intergenic
1047949803 8:129922975-129922997 ATCCCAGCACTTTGGAAGGCAGG + Intronic
1047969324 8:130071222-130071244 ATCTAAGCTCTGTGGAAGGATGG - Intronic
1048014394 8:130484414-130484436 ATCCCAGCACTTTGGATGGCCGG - Intergenic
1049192560 8:141296581-141296603 ATCCTAGCACTTTGGGAGGCTGG + Intronic
1049283713 8:141763337-141763359 GTCCTACCACTGGGGAAGGAGGG + Intergenic
1049723206 8:144130975-144130997 ATCCCAGCACTCTGGGTGGCCGG - Intergenic
1049836277 8:144737574-144737596 ATCCCAGCACTTTGGTTGGGAGG + Intronic
1050104578 9:2152297-2152319 ATCCCAGCACTTTGGGTGGCCGG + Intronic
1050275822 9:3998319-3998341 TTCCTAGCTCTGTGCATTGAAGG - Intronic
1050546402 9:6713407-6713429 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1050552704 9:6761570-6761592 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1050654682 9:7814059-7814081 ATCTTAGCACAGTGTATGGATGG - Intronic
1051288013 9:15515632-15515654 ATCCTAGCACTCTGGGAGGCCGG - Intergenic
1051641352 9:19227708-19227730 ATCCTAGCACTTTGGGTGGCCGG + Intergenic
1052906303 9:33837340-33837362 ATCACAGCACTGTGCATGGTCGG - Intronic
1052938862 9:34116109-34116131 ATCCTAGCACTTTGGGAGGTGGG + Intronic
1053084912 9:35210774-35210796 ATCCCAGCACTTTGGGAGGACGG - Intronic
1053322620 9:37113758-37113780 ATCCCAGCACTTTGGGTGGCTGG + Intergenic
1053790678 9:41684251-41684273 ATCCCAGCACTTTGGAAGGCTGG - Intergenic
1054154486 9:61630521-61630543 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1054474260 9:65561641-65561663 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1054658514 9:67684876-67684898 ATCCCAGCACTTTGGAAGGCTGG + Intergenic
1055289099 9:74763900-74763922 ATCCCAGCACTGTGGGAGGCAGG + Intronic
1056327578 9:85492730-85492752 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1056523784 9:87424080-87424102 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1057178243 9:93014883-93014905 ATCCCAGCACTTTGGGTGGGTGG - Intronic
1057278941 9:93696953-93696975 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1057711706 9:97451405-97451427 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1057840309 9:98480989-98481011 ATCATTCCCCTGTGGATGGAAGG + Exonic
1058021526 9:100094714-100094736 ATCCTAACACTTTGGAAGGCAGG + Intronic
1058033129 9:100221418-100221440 ATCCTAGCACTCTGGGAGGCCGG - Intronic
1058675859 9:107399423-107399445 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1058863562 9:109140787-109140809 ATCCCAGCACTTTGGGAGGATGG - Intronic
1059481503 9:114594319-114594341 ATCCTAGCACTCTGGGAGGCCGG - Intronic
1060559977 9:124534876-124534898 ATCCCAGCACTTTGGAAGGCAGG + Intronic
1060703153 9:125777263-125777285 ATCCTAGCACGTTGGGTGGCTGG - Intronic
1060914862 9:127382046-127382068 ATCCCAGCACTGTGGGAGGCTGG + Intronic
1061047138 9:128172037-128172059 ATCCCAGCACTTTGGGAGGAGGG + Intronic
1061334041 9:129917585-129917607 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1061919970 9:133777389-133777411 AGCCCTGCCCTGTGGATGGAAGG - Exonic
1061985115 9:134126105-134126127 ATCCCAGCACTTTGGGTGGGTGG + Intergenic
1062477418 9:136735691-136735713 ATCCCAGCACTTTGGAAGGGAGG - Intergenic
1185637967 X:1568758-1568780 ATCCTAGCACTTTGGAAGCCAGG + Intergenic
1185723378 X:2399784-2399806 ATCCCAGCACTTTGGAAGGTGGG + Intronic
1186976032 X:14905742-14905764 ATCCTAGCACTTTGGGAGGGCGG - Intronic
1187295258 X:17993191-17993213 ATCCTTCCACTGGGGATGCAGGG - Intergenic
1187360243 X:18619242-18619264 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1187545440 X:20247180-20247202 ATCCCAGCACTTTGGATAGGTGG + Intronic
1187993782 X:24904183-24904205 ATCCTAGCACTTTGGGAGGTCGG - Intronic
1188642664 X:32525372-32525394 ATGCCAGCAATGAGGATGGAAGG + Intronic
1188647692 X:32591109-32591131 ATCCCAGCACTTTGGAAGGCTGG - Intronic
1189437267 X:41004223-41004245 ATCCCAGCACTGTGGGAGGCTGG + Intergenic
1189774842 X:44461383-44461405 ATCCTAGCACTCTGGGAGGCCGG + Intergenic
1190081087 X:47357375-47357397 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
1190317541 X:49161118-49161140 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1190868281 X:54403135-54403157 ATCCCAGCACTGTGGGAGGCCGG - Intergenic
1192364805 X:70462508-70462530 ATCCTAGCACTTTGGGAGGCTGG - Intronic
1192461994 X:71324811-71324833 ATCCTAGCACTTTGGGAGGTGGG - Intergenic
1192777638 X:74261524-74261546 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1192895322 X:75437131-75437153 ATCCCAGCACTTTGGGTGGCCGG - Intronic
1193082541 X:77420381-77420403 ATCCTAGCACTTTGGGAGGCTGG - Intergenic
1193385388 X:80865152-80865174 ATCCTAGCACTTTGGGAGGCCGG + Intergenic
1193690148 X:84631532-84631554 ATCCTAGCACTTTGGGAGGCCGG - Intergenic
1195133740 X:101881704-101881726 ATCCCAGCACTTTGGGTGGCTGG - Intergenic
1196098426 X:111823976-111823998 ATCCTAGCACTTTGGGAGGATGG + Intronic
1196671324 X:118370832-118370854 ATCCCAGCACTTTGGGAGGATGG - Intronic
1198464809 X:136895356-136895378 ATCCTAGCACTTTGGGAGGTGGG - Intergenic
1200009896 X:153113046-153113068 ATCCCAGCACTGTGGGAGGCTGG + Intergenic
1200029704 X:153286876-153286898 ATCCCAGCACTGTGGGAGGCTGG - Intergenic