ID: 1151230683

View in Genome Browser
Species Human (GRCh38)
Location 17:72682996-72683018
Sequence TTTGCAGGAGGACTCAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151230683_1151230687 -6 Left 1151230683 17:72682996-72683018 CCTCTTTTGAGTCCTCCTGCAAA 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1151230687 17:72683013-72683035 TGCAAACTGGCATCTACAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 116
1151230683_1151230688 28 Left 1151230683 17:72682996-72683018 CCTCTTTTGAGTCCTCCTGCAAA 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1151230688 17:72683047-72683069 ACAGCACCTTTACTGTCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151230683 Original CRISPR TTTGCAGGAGGACTCAAAAG AGG (reversed) Intronic
900827530 1:4938785-4938807 TCTGGAGGAGGACTGAGAAGGGG - Intergenic
901690130 1:10967404-10967426 TTTGCACAAGGACTGAAAGGAGG - Intronic
902539392 1:17142477-17142499 TTTGAAGGGAGACTCAAAGGAGG + Intergenic
904744596 1:32702981-32703003 GTTGCAGGGGGAGTCAGAAGGGG + Exonic
904776862 1:32914562-32914584 TGAGCAGGAGGTCTCAACAGGGG + Intergenic
905103693 1:35548351-35548373 TTTGCAGGAGTATAGAAAAGTGG - Intronic
905174520 1:36127320-36127342 TTGGCAGGGGGACAGAAAAGTGG - Intergenic
910983563 1:92982493-92982515 TTAGCAGTAGGTCTCAACAGTGG - Intergenic
915006488 1:152642575-152642597 TGAGCAGTAGGCCTCAAAAGTGG + Intergenic
915103261 1:153515785-153515807 TGTGGAGGAGGACTGGAAAGGGG + Intergenic
919019543 1:192086337-192086359 TTTGCAAGAGTACTTAAAATAGG + Intergenic
919160067 1:193817709-193817731 TAAGCAGGAGGTCTCAACAGTGG + Intergenic
920760056 1:208774890-208774912 TTTGGAGGAGGATTCACAGGTGG + Intergenic
921306863 1:213806007-213806029 TGAGCAGGAGGTCTCAACAGTGG + Intergenic
921576368 1:216839830-216839852 TGAGCAGGAGGTCTCAACAGTGG + Intronic
923191127 1:231621845-231621867 GTTGGAGGAGGACTGTAAAGGGG + Intronic
924802694 1:247338984-247339006 TTTGCTGCAGGCCTCAAATGGGG + Intergenic
1062771887 10:107910-107932 TTTGCAGGGGGACTACAATGTGG + Intergenic
1065524985 10:26611027-26611049 TTTGAAGGAGGGGTGAAAAGTGG - Intergenic
1067548247 10:47212428-47212450 TGAGCAGTAGGTCTCAAAAGTGG - Intergenic
1068629999 10:59288868-59288890 TGTTCAGGAGGACTTACAAGTGG - Intronic
1068940830 10:62679245-62679267 TGAGCAGTAGGACTCAATAGTGG + Intergenic
1069883367 10:71608098-71608120 TTTGCAGGAGGTCTCACAACTGG + Intronic
1071073030 10:81716072-81716094 TTTCCAGGTGGATTCAAAATAGG + Intergenic
1073481232 10:103787382-103787404 TGTGTAGGAGGACTCCAAAATGG - Intronic
1077820937 11:5739896-5739918 TTTGCATGAGGACTCTGAACTGG + Intronic
1080640418 11:34155265-34155287 TTTGCACAAGGACTCCAATGTGG + Intronic
1083721308 11:64604943-64604965 TTTGCAGGAGGAATCTCAAGAGG + Intergenic
1085441130 11:76563624-76563646 TTAGCAGTAGGTCTCAATAGTGG + Intergenic
1086230383 11:84562373-84562395 TTTGCATGTGGATTCAAAGGAGG + Intronic
1086454911 11:86951749-86951771 TTGGCAGCAGGACTCAAATGGGG - Exonic
1087768860 11:102185120-102185142 TTTCCAACAGGAATCAAAAGAGG - Intronic
1089675539 11:120086179-120086201 AGTGCTGGAGGACCCAAAAGAGG + Intergenic
1089709724 11:120306304-120306326 TTTGCAGGAGGACTCAGTGAGGG + Intronic
1090067968 11:123519412-123519434 TTGGCTGGAGGACTAGAAAGAGG + Intergenic
1090127598 11:124104460-124104482 ATTGCAGGATGAGTAAAAAGAGG + Intergenic
1091631894 12:2168271-2168293 TATGAAGGATGAATCAAAAGAGG + Intronic
1092556827 12:9568947-9568969 TTTGTATGAGGTCACAAAAGGGG - Intergenic
1092665042 12:10786994-10787016 TTTGCATGTGCACTCAAAAATGG + Intergenic
1093603607 12:21062463-21062485 TTTGTAAGAAGACTCAAAATAGG + Intronic
1096561871 12:52441410-52441432 TTTGAAGGAAGACTCAGCAGAGG + Intergenic
1097453616 12:59767638-59767660 TTAGCAGCAGGTCTCAACAGTGG - Intronic
1098058551 12:66535107-66535129 TTTCCAGGAAGACTTAAAGGAGG - Intronic
1098889970 12:75999984-76000006 TTAGCAGTAGGCCTCAACAGTGG + Intergenic
1101137986 12:101765193-101765215 TTTGCAGAAGTAGCCAAAAGAGG - Exonic
1104108568 12:125685786-125685808 TTTGCCAGAAGCCTCAAAAGTGG + Intergenic
1104571248 12:129927797-129927819 TTTGCTGGAGGCATCAGAAGAGG + Intergenic
1109251478 13:60025797-60025819 TTTGTAGGAGGACTGAGATGAGG + Intronic
1109545962 13:63839314-63839336 TTTGTATGAGGTCACAAAAGGGG + Intergenic
1112653326 13:101421797-101421819 TGAGCAGTAGGACTCAACAGTGG + Intergenic
1113340893 13:109424751-109424773 TTTGCAGGAGGAAGAAAAAAAGG + Intergenic
1113788947 13:113017216-113017238 TTGTCATGAGGACACAAAAGGGG - Intronic
1114574574 14:23700393-23700415 TTTGGATGAGGACTCAGAAGAGG + Intergenic
1117895464 14:60480593-60480615 TTTGGACGAATACTCAAAAGTGG - Intronic
1119856537 14:77905188-77905210 TTTGCAGGGAGACCAAAAAGGGG + Intronic
1119964442 14:78898336-78898358 TTTGAAGGATGACTGAAATGTGG + Intronic
1121252317 14:92508892-92508914 TCTGCAGTAGGTCTCAACAGTGG + Intergenic
1121474033 14:94177936-94177958 TTTGCAAGGTGACTCACAAGGGG + Intronic
1126886072 15:53151976-53151998 TGAGCAGTAGGTCTCAAAAGTGG - Intergenic
1129893326 15:79086497-79086519 TGTGCATGAGGACTCAGGAGTGG + Intronic
1130343017 15:83015026-83015048 TTTGAAGAAGCACTAAAAAGTGG + Intergenic
1132223476 15:100123051-100123073 TCTGGGGGAGGACTCAAAGGAGG + Intronic
1133722575 16:8508591-8508613 TTTTCAGGAGCCCTCAAAGGGGG - Intergenic
1136171912 16:28494950-28494972 TTTGCAGAAGGAGCCAGAAGGGG - Intronic
1137883573 16:52078012-52078034 TTTGCAGCAGTTCTCAAACGTGG + Intronic
1142380455 16:89729113-89729135 TTTTCAGAAGAACTCAAATGTGG + Intronic
1142696469 17:1636635-1636657 TTTGCTGGAGGACTAAAGAGGGG + Intronic
1143250786 17:5521646-5521668 TTTTCAGGAGGACTCCCAAGGGG + Exonic
1144413523 17:15023904-15023926 TATGCAGGGGCACCCAAAAGGGG - Intergenic
1144638253 17:16924366-16924388 TTTTCAGGAGAACTCGAGAGAGG - Intergenic
1147040732 17:37716646-37716668 CTTGCAGGAGGACCCCAGAGAGG + Intronic
1147946984 17:44085961-44085983 ATTTCAGGAGGAGTCAAGAGGGG - Intronic
1148238360 17:45983827-45983849 TTTGGGAGAGGACACAAAAGAGG + Exonic
1149302600 17:55318698-55318720 TTTCCAAGAGCACTCAAAAGAGG - Intronic
1151230683 17:72682996-72683018 TTTGCAGGAGGACTCAAAAGAGG - Intronic
1152814621 17:82400063-82400085 TTCCCAGGAGGACTCAGAGGAGG - Intronic
1153990507 18:10394905-10394927 TTTGCAGAAGAACACACAAGTGG - Intergenic
1153994076 18:10424425-10424447 TTTGAAGGAGGACACCAAGGAGG - Intergenic
1154028862 18:10732718-10732740 TTTTCAGGAGGACTGAATAAAGG + Intronic
1155262091 18:24052990-24053012 TTTGTAGCAGGATTCAAAAAGGG + Intronic
1156648069 18:39190909-39190931 TTTGAAGGAAGAGTAAAAAGAGG + Intergenic
1157672841 18:49544814-49544836 TTGGCAGGAGGACTTCATAGAGG + Intergenic
1158339071 18:56445979-56446001 TTTTCAGGAGTGCTAAAAAGAGG + Intergenic
1158550368 18:58430784-58430806 TTTGAAGGAGAGCTCACAAGAGG + Intergenic
1159088566 18:63821310-63821332 CTTGCAGAAGTACACAAAAGGGG - Intergenic
1161440807 19:4290648-4290670 TGGGCCCGAGGACTCAAAAGGGG - Exonic
1161771581 19:6233834-6233856 TTTCCTTGAGGACTCAAATGTGG + Intronic
1162047307 19:8008855-8008877 TTCGCAGAGGGACCCAAAAGAGG + Intronic
1164299020 19:23942830-23942852 TTAACATAAGGACTCAAAAGTGG - Intronic
1165741762 19:38209189-38209211 TTTGCTGCAAGACTCACAAGGGG + Intergenic
1166273633 19:41735061-41735083 TTTTCAGGAGGCCTTAAAGGGGG + Intronic
926938497 2:18111319-18111341 TTGGCAGGATGAATCAAAAAGGG + Intronic
928951462 2:36817146-36817168 TTTGAAGGAGGACTAGGAAGGGG + Intergenic
930322076 2:49868171-49868193 TTAGCAGTAGGTCTCAACAGTGG + Intergenic
932349814 2:71022764-71022786 TTTGTAGGAGGTCACAAAGGGGG + Intergenic
933043096 2:77494780-77494802 GATGCAGGAGGACTGAAGAGGGG - Intronic
934707792 2:96496930-96496952 TTAGAAGAAGGACTCAAAACTGG - Intergenic
938732067 2:134154374-134154396 TATGGAGGAGGACACAGAAGGGG - Intronic
938791224 2:134678171-134678193 TTTGCAGCTGGACTCAGAAATGG - Intronic
939556118 2:143675650-143675672 TGAGCAGTAGGACTCAACAGAGG + Intronic
940608489 2:155959667-155959689 TTTGCAGTTGGTCTCAACAGGGG - Intergenic
941614435 2:167703196-167703218 TTTGCAGGAGGAAACAAATGAGG + Intergenic
941862113 2:170293585-170293607 TTGGCTGGAAGACTGAAAAGGGG - Intronic
942971250 2:181961031-181961053 TTTGCTGGAGAAATCAGAAGAGG + Intronic
942980986 2:182081376-182081398 TTTGAAAGAAGACTGAAAAGAGG - Intronic
943552460 2:189357414-189357436 TTTTCAGGAGGAATCTAGAGAGG + Intergenic
945510036 2:210689646-210689668 TTGGCAGCTGGAATCAAAAGAGG + Intergenic
946903512 2:224394662-224394684 GGTGCAGGAGGACACAAAATGGG - Intronic
1168795057 20:605816-605838 GTGGCTGGAGGCCTCAAAAGAGG - Intronic
1173418116 20:42876661-42876683 GTTTCAGGAGGACCCTAAAGGGG - Intronic
1174608487 20:51779241-51779263 TGTGCAGTAGGTCTCAACAGTGG + Intergenic
1174692473 20:52520978-52521000 TTGGCAGTAGGTCTCAATAGTGG + Intergenic
1175722565 20:61296004-61296026 TTTTCAGGAGGACGGAGAAGGGG + Intronic
1178490593 21:33048656-33048678 CTTGCAGGAGGACATACAAGTGG - Intergenic
1178618740 21:34156169-34156191 AGTCTAGGAGGACTCAAAAGAGG + Intergenic
1181000968 22:19987517-19987539 TTTGCAGGCGGACTGAAGTGTGG - Intronic
1181107996 22:20585957-20585979 TGTGCAGGAGGAGCCAGAAGAGG - Intronic
1181520282 22:23444379-23444401 TGAGCAGGAGGTCTCAACAGTGG + Intergenic
1182393612 22:30019735-30019757 CTTGCAGGAGGCCACCAAAGAGG + Exonic
949882921 3:8675719-8675741 TTTGCATGAGGTCACAAAGGGGG + Intronic
950786930 3:15444705-15444727 TTTGCAGGTGGACAGATAAGAGG + Intronic
952015675 3:28953976-28953998 TCAGCAGGAGGTCTCAACAGTGG - Intergenic
952926934 3:38326995-38327017 TTTCCAGAAGGACTCCAGAGAGG - Intergenic
953121748 3:40050439-40050461 TGAGCAGTAGGTCTCAAAAGTGG - Intronic
954675064 3:52311140-52311162 TTGCCAGCAGGACTCAACAGGGG - Intergenic
960811681 3:121632600-121632622 TTTCCAGGAGGAATCAATGGAGG + Intronic
961274987 3:125719442-125719464 TTTGTATGAGGTCACAAAAGGGG + Intergenic
962982275 3:140501350-140501372 TTTGCAGGAGGACTGGTATGAGG - Intronic
967221285 3:187250144-187250166 TTGGCAGGAGCACTCTAAGGGGG - Intronic
968921814 4:3526144-3526166 TTTGCTGCAGGACTCCACAGAGG - Intronic
969072855 4:4553278-4553300 CTTCCAGGAAGACACAAAAGGGG - Intergenic
969899788 4:10338212-10338234 TTTGCAGAAGGCATCATAAGGGG - Intergenic
973342156 4:49016601-49016623 TTTGGATGAGGCCACAAAAGAGG + Intronic
975791342 4:77955108-77955130 CTTGCAGGAGGTCTCCTAAGTGG + Intergenic
981573882 4:146183361-146183383 TTTGCAGGAGTATTCAAGATTGG + Intronic
981924360 4:150121931-150121953 TTTCCAGTAGGTCTCAACAGTGG + Intronic
982305485 4:153926120-153926142 TTTGTAGTAGGACTAAATAGTGG - Intergenic
984290788 4:177791416-177791438 CTTGCAGGAAGACACAACAGAGG - Intronic
985338118 4:188917841-188917863 TTAGCAGTAGGTCTCAACAGTGG + Intergenic
986002379 5:3640571-3640593 TTTGGAGGAAGACCCAGAAGTGG - Intergenic
986342658 5:6804249-6804271 TCTGCAGGAGGATTCACAAGAGG - Intergenic
987340368 5:16934856-16934878 TTTGCTGGAAGACTCCAAAGCGG + Intronic
989532880 5:42527975-42527997 TGTGCAGGAGGTCTCAACTGTGG - Intronic
990876580 5:60493302-60493324 TTTGAAGGAGGAGAAAAAAGAGG + Intronic
991426886 5:66500858-66500880 TTTCCATGAGGAGTCAAGAGGGG - Intergenic
992095850 5:73361802-73361824 TTTTCAGGAGCAATCAACAGGGG + Intergenic
992761944 5:79958180-79958202 TTTCCAGGAGCACACAAAGGAGG + Intergenic
994594639 5:101816894-101816916 TTTTGAGGAGGACTCCAAAGAGG - Intergenic
995596668 5:113755022-113755044 TTTACAAGAGGGCTTAAAAGAGG - Intergenic
1000621641 5:163493162-163493184 TTTGGAGTAGGACTCAGAATAGG - Intergenic
1001183344 5:169541878-169541900 TTTGCAGCAGGTCTCAACAATGG - Intergenic
1004230300 6:13827030-13827052 TTTGCAGAAGGAGTAAAACGTGG - Intergenic
1006826318 6:36938835-36938857 TTCCCAGGAGGCCTGAAAAGGGG - Intergenic
1006947283 6:37793151-37793173 TTTGCAGCAGCACTCCAAGGTGG - Intergenic
1007038053 6:38696181-38696203 TTTTCAGGATGAATCAAAACTGG + Intronic
1007684977 6:43661101-43661123 TGAGCAGTAGGTCTCAAAAGTGG + Intronic
1008112495 6:47507925-47507947 TCTGCAGTAGGTCTCAACAGTGG + Intronic
1011178522 6:84592263-84592285 TGAGCAGCAGGTCTCAAAAGTGG + Intergenic
1014590676 6:123263933-123263955 TTAGCAGTAGGTCTCAACAGTGG - Intronic
1014856180 6:126404119-126404141 TGTGCAGTAGGTCTCAACAGTGG - Intergenic
1014945276 6:127490215-127490237 TGAGCAGTAGGTCTCAAAAGTGG - Intronic
1015664841 6:135617277-135617299 TTGGCTGCAGGACTGAAAAGAGG + Intergenic
1015887688 6:137935524-137935546 TTTGGAGGTGTACTCAGAAGTGG + Intergenic
1016562688 6:145414603-145414625 TTTGCCTGAAGACTCAAAGGAGG - Intergenic
1017372102 6:153723058-153723080 TTTGCAGGAAGACTGCAAAAGGG + Intergenic
1017608547 6:156159099-156159121 TCTGCAGGAGGAATGAAGAGGGG - Intergenic
1019590960 7:1831849-1831871 TGAGCAGGAGGTCTCAACAGTGG - Intronic
1020177590 7:5895456-5895478 ATTGCAGGAGGCATCGAAAGAGG - Intergenic
1020305324 7:6829490-6829512 ATTGCAGGAGGCATCGAAAGAGG + Intergenic
1020651979 7:10886555-10886577 ATTTCAGGAGTACTCAAAATGGG + Intergenic
1023993166 7:45142329-45142351 TTTACAGTAGGGCTGAAAAGGGG + Intergenic
1024066282 7:45739300-45739322 TTTGCAGGAGCAGTGAAGAGAGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1027006164 7:74695012-74695034 TGAGCAGTAGGTCTCAAAAGTGG - Intronic
1028770925 7:94620764-94620786 TTTGCAGCAGGTCTCAGAAAAGG - Intronic
1028853518 7:95564239-95564261 TTTCAAGGAGAACTCAAAAAAGG - Intergenic
1029056798 7:97753604-97753626 TTTGCTGGAGGAAAGAAAAGAGG + Intergenic
1029081249 7:97975545-97975567 ATTGCAGGAGGCATCGAAAGAGG + Intergenic
1035927109 8:3740449-3740471 TTTGCAGGAGAACTCAGAAGTGG + Intronic
1036388648 8:8305619-8305641 TTTGCCAGAGGACTAAGAAGAGG + Intergenic
1036535863 8:9651491-9651513 TTTAGAGGAGGACTTAGAAGGGG + Intronic
1039377760 8:37053658-37053680 GTTGCAGGTGGAGACAAAAGTGG + Intergenic
1041888043 8:62835548-62835570 TTTGAAAGAAGACTTAAAAGCGG + Intronic
1041980228 8:63849185-63849207 TCTGCAGTAGGATGCAAAAGAGG + Intergenic
1042787857 8:72568876-72568898 GTTAAAGGAGGCCTCAAAAGGGG - Intronic
1044898979 8:96924123-96924145 GCTGCAGGTGAACTCAAAAGTGG + Intronic
1048659099 8:136575751-136575773 TTGGCAGGAGGGCCCAGAAGAGG - Intergenic
1048876482 8:138840359-138840381 TTTCCAGGGAGACTCCAAAGAGG + Intronic
1048902545 8:139052844-139052866 TTAGCAGTAGGTCTCAACAGTGG - Intergenic
1050677366 9:8071311-8071333 CCTGCAGGAGGATCCAAAAGGGG + Intergenic
1051064472 9:13085935-13085957 TTTGGAGCAGGTCTCAACAGTGG - Intergenic
1051761842 9:20475797-20475819 TTTGGAGGAGGACTCAACTTTGG - Intronic
1051779799 9:20677822-20677844 TTTGGAGGTATACTCAAAAGTGG - Intronic
1053250470 9:36570192-36570214 TTAGAAGTAGGTCTCAAAAGTGG - Intergenic
1053474635 9:38373072-38373094 TTTGCTGGAGAGCTCAAAATTGG - Intergenic
1054875290 9:70089829-70089851 TTTGCAGGAGGACTTATTATGGG - Intronic
1055622513 9:78141255-78141277 TTTGTAGGCACACTCAAAAGTGG - Intergenic
1055972965 9:81930110-81930132 TTTGCAGAAGGAAGCAGAAGAGG + Intergenic
1055974718 9:81945182-81945204 TTTGCAGAAGGAAGCAGAAGAGG + Intergenic
1059092927 9:111380374-111380396 TTAGCAGTAGGCCTCAACAGTGG + Intronic
1059228201 9:112692669-112692691 TTTGCAGAATGATTAAAAAGTGG + Intronic
1059572410 9:115453545-115453567 TTAGCAGTAGGTCTCAAAATTGG + Intergenic
1060356542 9:122913816-122913838 TGTTCAGGAGGACTCACAAAAGG - Intergenic
1188322057 X:28751807-28751829 TTTGCAGCTGGACTCAAACAGGG - Intronic
1189072510 X:37878929-37878951 TAAGCAGGAGGTCTCAATAGTGG - Intronic
1190397835 X:50002764-50002786 TTAGAAAGAGGACTCAAAAAAGG - Intronic
1191668599 X:63728417-63728439 TTTCCAGCAGGACGCAAAGGTGG + Intronic
1197300956 X:124779990-124780012 TTAGCAGGAAAACACAAAAGAGG + Intronic
1198428031 X:136539290-136539312 TTTGCAGCAAAACTCAAAATTGG + Intronic
1200094212 X:153649745-153649767 TTGGGAGGAGTACTCACAAGGGG - Intronic