ID: 1151235736

View in Genome Browser
Species Human (GRCh38)
Location 17:72718571-72718593
Sequence CGTGCCTGGCTGTGACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151235736_1151235739 18 Left 1151235736 17:72718571-72718593 CCTTGGGGTCACAGCCAGGCACG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1151235739 17:72718612-72718634 ATAATTAAGAGCACAGGCTCTGG 0: 1
1: 3
2: 28
3: 164
4: 741
1151235736_1151235738 12 Left 1151235736 17:72718571-72718593 CCTTGGGGTCACAGCCAGGCACG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1151235738 17:72718606-72718628 AGAGTGATAATTAAGAGCACAGG 0: 1
1: 0
2: 2
3: 24
4: 236
1151235736_1151235740 24 Left 1151235736 17:72718571-72718593 CCTTGGGGTCACAGCCAGGCACG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1151235740 17:72718618-72718640 AAGAGCACAGGCTCTGGAGCTGG 0: 3
1: 7
2: 50
3: 162
4: 728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151235736 Original CRISPR CGTGCCTGGCTGTGACCCCA AGG (reversed) Intronic
900108359 1:995709-995731 CATGCCTGGCTGCTGCCCCACGG - Intergenic
900154414 1:1198250-1198272 CCTGCCGCCCTGTGACCCCACGG + Intergenic
900516850 1:3086235-3086257 CTTGCCTGGCTGTGACAGCCAGG + Intronic
900869773 1:5293690-5293712 CTTGCCTTGGTTTGACCCCAGGG + Intergenic
901120019 1:6883574-6883596 CTTGCCTGGCTTAGACCACATGG - Intronic
901637456 1:10676945-10676967 CCTGACTGGCTGTGCCCACAGGG - Intronic
902706669 1:18210072-18210094 AGTGCCTGGATGTCACCCGAAGG - Intronic
903330585 1:22595130-22595152 CCTGCCTGGCTGTGACCCTGGGG - Intronic
904370315 1:30044011-30044033 AGGCCCTGGCTGTTACCCCAGGG + Intergenic
906215053 1:44033830-44033852 CGTCCCTGGCTGTGAGCCCCTGG + Intergenic
907816088 1:57919461-57919483 CCTGACTGCCTCTGACCCCAGGG - Intronic
908833173 1:68202107-68202129 CTTGCCTGGCTTGGATCCCATGG + Intronic
911329416 1:96510068-96510090 CATGCCTGGCAGTGATACCAGGG - Intergenic
913671539 1:121101071-121101093 GGAGCCTGGCTGTGACTTCAAGG + Intergenic
914023310 1:143888507-143888529 GGAGCCTGGCTGTGACTTCAAGG + Intergenic
914459373 1:147868911-147868933 GCTGCCTTGCTGTGACTCCAGGG - Intergenic
914661793 1:149796447-149796469 GGAGCCTGGCTGTGACTTCAAGG + Intronic
915948381 1:160170990-160171012 AGTGCCTGGTTCTGCCCCCAGGG + Intronic
915972284 1:160363239-160363261 CTTGCCTGGTTGGGTCCCCAGGG + Intergenic
919658837 1:200223396-200223418 TGTTCCTGGCTGTATCCCCAGGG - Intergenic
920070474 1:203299278-203299300 CTTGCCTGGCGGTGAGCCCAGGG + Intergenic
924579830 1:245314109-245314131 AGTCCCTGTCTCTGACCCCAAGG - Intronic
1064304613 10:14153954-14153976 CTTTCCTGGCTGTGTCCCAACGG + Intronic
1064315400 10:14250813-14250835 AGTGCCTGGCTGTGACTCCTGGG - Intronic
1065485678 10:26234411-26234433 ATTGACTGGCTGTGACACCATGG - Intronic
1067505125 10:46841768-46841790 CATTCCTGGCAGGGACCCCAGGG + Intergenic
1067699421 10:48557980-48558002 CGTGCCTTGGAGTCACCCCAGGG + Intronic
1069630675 10:69895323-69895345 CCTGCCTGGAAGTGGCCCCAGGG - Intronic
1069757915 10:70785151-70785173 CCTGGCTGGCTGGGGCCCCAGGG - Intronic
1071525629 10:86356451-86356473 TGTGACTGGCTGTGGCCACATGG + Intronic
1075176256 10:120164031-120164053 CTTGCCTGGCTGTGTCCCTTGGG + Intergenic
1075673462 10:124280120-124280142 CGTGCCTGGCTCTGTCTGCAGGG + Intergenic
1076723159 10:132401539-132401561 CTGGCCTGGCTGTGACCCACAGG - Intronic
1076742481 10:132493590-132493612 TGTGCCTGGCTGTCTCCTCAGGG - Intergenic
1076800876 10:132827536-132827558 CGAGCCTTCCTGTGACCCCAAGG - Intronic
1077160993 11:1112845-1112867 TCTGCCTGGCTGTGACCCTTGGG + Intergenic
1077252153 11:1565464-1565486 CGCCCCTGGCTGTGACCCCAAGG + Intronic
1077311363 11:1890338-1890360 CGTGCGGGGCTGTGACCTCCTGG + Exonic
1077410850 11:2403290-2403312 CGTGTCTGGCTTCGACCCCTCGG - Exonic
1078103646 11:8344960-8344982 CCTGCCTGGCAAAGACCCCAAGG + Intergenic
1079248804 11:18772605-18772627 CGGGCATGGCAGGGACCCCAGGG + Intronic
1084269751 11:68022548-68022570 CGGTCCTGACTGTGGCCCCAGGG + Intronic
1084442966 11:69186401-69186423 CGTGCTGGGATGTGAACCCAGGG + Intergenic
1085315461 11:75542221-75542243 TCAGCCTGGGTGTGACCCCAAGG - Intergenic
1089363161 11:117904230-117904252 CGTGCCTGGCTCCCACCCAAGGG + Intronic
1090597412 11:128334740-128334762 CGAGCCTGGCCCTGACCCCTGGG + Intergenic
1091582604 12:1798307-1798329 AGGGCCTGGCTGTGGCCCCCAGG + Intronic
1095102810 12:38201724-38201746 CGTCCCTGGCAGGGAGCCCAGGG - Intergenic
1095981019 12:47974885-47974907 TGTGCCTGTCTGAGCCCCCATGG - Intronic
1096841973 12:54385298-54385320 AATGCCTGGGTCTGACCCCAAGG + Intronic
1101397576 12:104362169-104362191 CGTGTGTGCCTGTGAGCCCAGGG - Intergenic
1102304007 12:111791335-111791357 TGTGCCTGGATTTGGCCCCACGG + Exonic
1103632772 12:122275862-122275884 CGTGCCTGGCTGTCTCTCCTAGG - Intronic
1103928907 12:124438589-124438611 CCTGCTTGGTTGAGACCCCATGG - Intronic
1104964940 12:132504678-132504700 CGGCCCTGGCTGGCACCCCAGGG + Intronic
1107102263 13:36606291-36606313 CTTGCCTGCCTGTGTTCCCATGG + Intergenic
1107416595 13:40206898-40206920 CCTGCCTGTCTGATACCCCAGGG + Intergenic
1107426355 13:40296967-40296989 GGTGCCTGGCTGGGATCTCAAGG + Intergenic
1108003253 13:45923796-45923818 CTGCCCTGGCTGTCACCCCACGG - Intergenic
1113350725 13:109526608-109526630 CGTGTCTGGCTGGAACACCATGG + Intergenic
1113418687 13:110152686-110152708 CCTGCATGGCTGGGGCCCCATGG + Intronic
1113427602 13:110222231-110222253 GGTGCTTGGCTGAGATCCCATGG - Intronic
1113427776 13:110223796-110223818 CCTGCCTGGGTGACACCCCAAGG + Intronic
1118972281 14:70646885-70646907 TGTGGCTGGCTCTGATCCCATGG - Intronic
1118978280 14:70695847-70695869 TCTGCCTGGCTGTGTCTCCATGG - Intergenic
1122424353 14:101597036-101597058 CGTGTCTTCCTGTGACCCCCTGG - Intergenic
1124071009 15:26393276-26393298 CATGCTAGGCTGTGAGCCCATGG + Intergenic
1127623511 15:60757654-60757676 CATCCCTGGATGTGACTCCAGGG + Intronic
1128111855 15:65081532-65081554 AGAACCTGGCTGTGAACCCAGGG + Intergenic
1128701074 15:69804843-69804865 AGTGCTTGACTGTGACTCCATGG - Intergenic
1128760747 15:70214702-70214724 CCTGACTAGCTGTGACCCCGAGG + Intergenic
1130033753 15:80339852-80339874 CGTCCTTGTCTGTGAGCCCAGGG + Intergenic
1130992937 15:88887319-88887341 CGGGCCAGGCTGGGGCCCCAGGG + Exonic
1132010585 15:98272758-98272780 CGTACCTCCCTGTGACCACAAGG - Intergenic
1132142509 15:99407329-99407351 CGTGCCTGGCTGGGACGGGAGGG - Intergenic
1135700027 16:24624276-24624298 CGTGTCCTGCTGTGACCCAATGG - Intergenic
1137505560 16:49051271-49051293 CAAGCCTGGCTCTGACCTCAGGG + Intergenic
1138652810 16:58471444-58471466 TGAGCCTGGCTTTGCCCCCAGGG + Intronic
1140469045 16:75204627-75204649 CATGGGCGGCTGTGACCCCAAGG + Intronic
1142132218 16:88436311-88436333 GGTGCCTGGCATTGACCCCTGGG + Exonic
1143474528 17:7195200-7195222 CTTCCCTGGTTCTGACCCCAGGG - Intronic
1144411210 17:15003947-15003969 CGTGCCTGGCTGTGGGTACATGG - Intergenic
1144941971 17:18948212-18948234 TGGGCTTGGCTGGGACCCCAGGG + Intergenic
1147446281 17:40477149-40477171 GGTGCCTGGCGGTGACCCACGGG - Exonic
1148786952 17:50150259-50150281 CGGGCCTGGCCGAGGCCCCACGG - Exonic
1150562226 17:66303347-66303369 CTTGCCGGGGTGTGAGCCCAGGG + Intronic
1151235736 17:72718571-72718593 CGTGCCTGGCTGTGACCCCAAGG - Intronic
1151534365 17:74730380-74730402 CCTTCCTGGCTGTGACCCAGTGG - Intronic
1152037840 17:77884166-77884188 CGAGCTTGGCTGTGACGGCAGGG - Intergenic
1152067399 17:78119193-78119215 CGGGCCTGGCTGTGGCCCCAGGG + Intronic
1152377831 17:79927884-79927906 CGGGGCTGGCTCTGGCCCCAAGG - Intergenic
1152649914 17:81488052-81488074 CGCGCCTGACTCTGTCCCCACGG - Intergenic
1156497104 18:37533121-37533143 CGTGCCTGGCTGAAACTCAAGGG - Intronic
1160944780 19:1636564-1636586 TGTGCACGCCTGTGACCCCAGGG - Intronic
1161588226 19:5117116-5117138 AGTGCCAGGCTGAGACCCCTGGG - Intronic
1162957187 19:14105955-14105977 AGTGCCTGGCTTTGAATCCATGG + Intronic
1163456014 19:17406036-17406058 GGGGCCTGGGTCTGACCCCAGGG + Intronic
1163460687 19:17435786-17435808 GGTTCCTGGCTGTGGACCCATGG - Exonic
1164589441 19:29498295-29498317 CAGGCCTGGGTGTGACCTCAGGG + Intergenic
1164714848 19:30384021-30384043 CCTGCATGCCTGTGGCCCCACGG + Intronic
1165805515 19:38578306-38578328 CCTGAGTGGCTGTGACCCTAGGG + Intronic
1166695785 19:44850952-44850974 CCTGCCTGGCTGGCTCCCCAGGG - Intronic
1166714845 19:44960456-44960478 CGTTCTTGGCTGTGACACCTTGG - Intronic
1167560604 19:50224650-50224672 TGTGCCAGGCTCTGACACCAAGG + Intronic
925090188 2:1148881-1148903 CCTGCCAGGCTGTGACACCAGGG - Intronic
926227989 2:10982036-10982058 GGTGCCAGGCTCTGTCCCCAAGG + Intergenic
926345181 2:11938231-11938253 CTTGCCTGGCTGGAACCCCCAGG - Intergenic
926571676 2:14536184-14536206 CGTGCCTTCCTGTGAGACCAGGG + Intergenic
927256617 2:21045082-21045104 TGAGCCTGGCTGTGTCCCCAAGG + Intergenic
929322099 2:40556570-40556592 CATGCAGGGCTGTGGCCCCATGG - Intronic
931094644 2:58925679-58925701 GGTGCCTGGGTGCGTCCCCAAGG + Intergenic
932338543 2:70944551-70944573 GGTGCCAGGCTGGGAGCCCAAGG - Intronic
932690988 2:73913573-73913595 CTTGGCTGGCCGTGACCTCACGG + Exonic
933760466 2:85668605-85668627 CCTGCCTGGCTCTTAACCCAGGG + Intronic
936240705 2:110786397-110786419 CGTGCCTGGCTGAAATCACAGGG - Intronic
937228375 2:120382808-120382830 AGTGCCTGGGTGTGAGCCCTGGG - Intergenic
938207847 2:129439094-129439116 TGTGCCTGGCTGAGCACCCATGG - Intergenic
938458895 2:131485082-131485104 CATGGGGGGCTGTGACCCCACGG - Intronic
945095746 2:206217380-206217402 GGTTCCTCGCTGTGACCCCCAGG - Exonic
945632276 2:212294920-212294942 CATGCCTGGCTTTGCCCTCAGGG - Intronic
945986677 2:216360107-216360129 AGTCCCAGGCTGTGATCCCAGGG - Intronic
946101603 2:217329956-217329978 CATGCCTGTCTTTGAACCCAGGG - Intronic
946108569 2:217393710-217393732 CGTGCAGGGCAGTGAGCCCATGG + Intronic
946490479 2:220144600-220144622 CGTGGCTGGCTTTGGTCCCATGG + Intergenic
948118478 2:235511365-235511387 AGGGCCTGGCTCAGACCCCAGGG - Intronic
948270753 2:236671517-236671539 TGTGCCTGTCTCTGCCCCCAAGG - Intergenic
948643025 2:239387363-239387385 CGTGCCTGGCCAGGACCACAGGG + Intronic
948703301 2:239774247-239774269 AGAGCTGGGCTGTGACCCCAGGG + Intronic
948786471 2:240355445-240355467 CATGCCTGCCTGTGTCCCCAGGG + Intergenic
949028028 2:241775351-241775373 GGTGCCTGGCCGTGACCCTCAGG + Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172204700 20:33154755-33154777 CCTGCCTGGCTCTGAAGCCATGG - Intergenic
1172627803 20:36358188-36358210 CGTGCCTCACTGTGGCCCCATGG - Intronic
1172759311 20:37310984-37311006 CCTGTGTGGCTGGGACCCCAGGG + Intronic
1172971274 20:38874647-38874669 AGTGCCAGGCTCTGAGCCCAAGG - Intronic
1173159819 20:40644160-40644182 CATGCCAGGCCCTGACCCCAAGG - Intergenic
1175898395 20:62350328-62350350 AGTGCCTGGGTGGGTCCCCAGGG + Intronic
1175958007 20:62621258-62621280 CCTGCCAGGCTGCGACCCCAGGG - Intergenic
1176089952 20:63314324-63314346 CCTGCCTGCCTGTGACCCCTGGG - Intronic
1176214980 20:63943770-63943792 CATGGCTGGCTGTGTCCCCGCGG - Intronic
1178503525 21:33145133-33145155 CGGGCCTGGCTGTAAACGCAAGG + Intergenic
1179805621 21:43835306-43835328 CGGGCCTGGCTGTGACTCCGGGG + Intergenic
1179962140 21:44773628-44773650 CGCGCCAGGCGATGACCCCATGG - Exonic
1180832058 22:18911452-18911474 GGTGCCAGGCAGTGAGCCCACGG - Intronic
1181067785 22:20314890-20314912 GGTGCCAGGCAGTGAGCCCACGG + Intronic
1181181653 22:21072884-21072906 CATGGGGGGCTGTGACCCCATGG - Intergenic
1181421305 22:22800909-22800931 CCAGCCTGGCTGGGAGCCCATGG - Intronic
1181462555 22:23094261-23094283 CTTCCCCGGCTGTGAGCCCAGGG - Intronic
1181516169 22:23414953-23414975 CGTGCCTGGCGGTGGCCGCTGGG + Intergenic
1182877501 22:33704878-33704900 CGTGTCTGGCTGTGGCCTCAGGG - Intronic
1183697993 22:39433994-39434016 CGTGCCTGGCTGGGACCTAGTGG - Intronic
1184767909 22:46581441-46581463 CGTGGGTGGCTTTGCCCCCAAGG + Intronic
1184786243 22:46673333-46673355 AGTGCCAGGCTGTGGCTCCAAGG - Intronic
1185006436 22:48279382-48279404 CGTGTCTGTCTGTGACCTAATGG - Intergenic
1185008391 22:48299321-48299343 CCTGCCTGGCTGTGACCTGGGGG - Intergenic
1203282144 22_KI270734v1_random:136757-136779 GGTGCCAGGCAGTGAGCCCACGG - Intergenic
950095722 3:10329158-10329180 CGAGCCTGGCTGTGGTCCCTGGG - Intronic
951011830 3:17690552-17690574 CTTGCTTGTCTGTGGCCCCAGGG - Intronic
953237332 3:41118104-41118126 TGTGGCTGCCTCTGACCCCAAGG - Intergenic
954345989 3:49999849-49999871 CTTGATTGTCTGTGACCCCAAGG + Intronic
956761332 3:72447315-72447337 CGTGCCTGTCGGTGGCCCCGCGG + Intergenic
965633285 3:170755517-170755539 CGTGCCCAGATGTGGCCCCAGGG + Intronic
968086650 3:195876891-195876913 TGTGCCTGCCAGTGTCCCCAGGG - Intronic
968789985 4:2652970-2652992 CCTGCCTGGCTGAGACCCTCGGG - Intronic
968818837 4:2835299-2835321 TGTGGGAGGCTGTGACCCCAGGG + Exonic
968982231 4:3856551-3856573 CATACCTGGCTCTGCCCCCATGG - Intergenic
969490400 4:7496340-7496362 CGCGCCTGGGTCTGACTCCAAGG + Intronic
969570744 4:8006741-8006763 CGCGCCTGCCTGTGCCCCCGTGG - Intronic
970035763 4:11734152-11734174 CGTGCCAGGCTCTGATCACAGGG + Intergenic
972475724 4:39447305-39447327 CGCGCCTGGCTGTGATTCCCTGG + Exonic
973697029 4:53500180-53500202 CTGGCCTGGCTGTGAACCCCTGG - Intronic
981318347 4:143363797-143363819 ACTGCCTGGGTGTGGCCCCAAGG - Intronic
984155413 4:176190629-176190651 ATTGCCTGGCTGTCAGCCCAAGG + Intronic
986291224 5:6400654-6400676 CTTTCCTGGCTGCTACCCCAAGG - Intergenic
989105582 5:37860258-37860280 TGTACTTGGCTGTGACCTCAGGG - Intergenic
993180857 5:84550037-84550059 CCTGGCTGGCTGTCACCCAAGGG - Intergenic
994697546 5:103091731-103091753 CATGCCTGGCTGAGACCCCTGGG - Intronic
994789517 5:104206052-104206074 GGTCCCTAGCTGGGACCCCAAGG - Intergenic
996302710 5:122007752-122007774 AGTGCCAGGCTGAGTCCCCAAGG - Intronic
997838930 5:137220337-137220359 CCTGCCTGGCAGTGCCCCCCAGG + Intronic
999476010 5:151899554-151899576 CATCCCCGGCTCTGACCCCAAGG + Intronic
1004180860 6:13379364-13379386 CAAGCCTGGCTGTGTGCCCATGG - Intronic
1004297186 6:14423511-14423533 AGTGCCTTGCTTTGTCCCCAGGG + Intergenic
1004977951 6:20988947-20988969 CGTGCCTGGCTGAGAACCACTGG + Intronic
1006365245 6:33611331-33611353 CGTGCCTGGCCCTGCCCCCGGGG + Intergenic
1006519264 6:34562075-34562097 CCTGCCTGGCTGGGTCCACATGG - Intergenic
1006837804 6:37009564-37009586 CGTGCTGGGATGTGACTCCAGGG - Intronic
1006886103 6:37383521-37383543 CCTGCCTGCCTGTGGCCACAGGG + Intronic
1007589326 6:43011984-43012006 CTTCCATGTCTGTGACCCCAGGG - Exonic
1012530412 6:100229068-100229090 CCTGCCTGGCTGGGCCGCCAGGG - Intergenic
1017837336 6:158190435-158190457 CTTGCCTGGATGTCACCTCATGG + Intronic
1019334194 7:475287-475309 CCGCCCTGGCTGGGACCCCAGGG + Intergenic
1019345902 7:530852-530874 CCTGCCTGGCTCTGGCCCCCAGG + Intergenic
1019448136 7:1081943-1081965 CAGGCCTGGCTATGACCGCACGG + Intronic
1019637135 7:2081885-2081907 CGTGCCCTGCTGTCTCCCCAGGG - Intronic
1022652847 7:32293129-32293151 AGTGCCTGGCTGTCACCCTGTGG - Intronic
1026434227 7:70380497-70380519 CGTCCGTGGCTGTGATCTCAGGG + Intronic
1027188654 7:75985828-75985850 CGGGCCTGGCTGCGACAGCAGGG + Exonic
1034787095 7:153935705-153935727 TGAGCCAGGCTGTGAGCCCAGGG - Intronic
1034878363 7:154744866-154744888 AGTGCCTGGCTGTGCTCCCTGGG - Intronic
1035236225 7:157499251-157499273 CGTGGCTGGCTCTGTCCACAGGG + Intergenic
1035565742 8:639697-639719 CGTGGCTGGCTGTGAATCCAGGG - Intronic
1035565758 8:639797-639819 CGTGGCTGCCTGTGAATCCAGGG - Intronic
1036444128 8:8806933-8806955 AGAGTCTGGCTGTGTCCCCAGGG - Intronic
1036462622 8:8967111-8967133 GGAGTCTGGCTGTGTCCCCAAGG + Intergenic
1037173338 8:15919623-15919645 CGCGCCTGGCTGTGAGCTGATGG - Intergenic
1038425150 8:27460021-27460043 CCAGCCTGGCTGTGACGCCCTGG - Exonic
1040106474 8:43545007-43545029 AGTCCCTGGCTGCCACCCCAGGG - Intergenic
1040109636 8:43561566-43561588 AGTCCCTGGCTTTCACCCCAGGG - Intergenic
1040109910 8:43562667-43562689 AGTTCCTGGCTCTGACCCCAGGG - Intergenic
1043446629 8:80325594-80325616 CCTGCCTGCCTGTCACCCCAGGG - Intergenic
1044820076 8:96150128-96150150 CTCGCCTGGCTGTGCACCCACGG + Intronic
1047024796 8:120812821-120812843 CATGCCTGCCTCAGACCCCAGGG + Intronic
1047676491 8:127208458-127208480 GGTACCTGTCTGTGTCCCCAGGG + Intergenic
1053186406 9:36020206-36020228 CGTGCCTGGCTGGGAATGCAAGG + Intergenic
1053428251 9:38025228-38025250 CGGGCCAGGCTGGGTCCCCATGG + Intronic
1058644362 9:107116828-107116850 CATGTCTGGCTGTGACGCCCGGG + Intergenic
1059391277 9:114001107-114001129 CCAGCCTGGCAGGGACCCCAGGG - Intronic
1060313611 9:122487709-122487731 CCTGCCTGGATGGGAACCCAGGG + Intergenic
1060595483 9:124845473-124845495 CGCGCCCGGCCGTGAACCCAAGG + Intergenic
1061386496 9:130293707-130293729 TGTGCCTGGCAGTGAGCTCAGGG + Intronic
1061394111 9:130333927-130333949 CCTGCCTGCCTGTGGCTCCAAGG - Intronic
1061758006 9:132828648-132828670 CGTGTCTGGGTGTGATCCCCAGG + Exonic
1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG + Intronic
1062231554 9:135484813-135484835 CGTTGCTGACTTTGACCCCATGG + Exonic
1062400409 9:136370244-136370266 CCAGCCTGGCTTGGACCCCAGGG + Intronic
1062522292 9:136963374-136963396 GGTCCCTGGCTCTGTCCCCACGG + Intergenic
1185512018 X:670760-670782 CATGCCTGCCTGGGTCCCCACGG - Intergenic
1193274897 X:79574163-79574185 TGTGGCTGGCTGTGACCATAAGG - Intergenic
1200063187 X:153492653-153492675 CATGCCTGGCTGAGACCTGAGGG + Intronic
1200854747 Y:7925368-7925390 CTTGCCTTGCTCTGACCACAGGG - Intergenic