ID: 1151237812

View in Genome Browser
Species Human (GRCh38)
Location 17:72734321-72734343
Sequence CAGGCTGCAGAGAAGGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 407}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151237812_1151237827 27 Left 1151237812 17:72734321-72734343 CCTCGTTCCTTCTCTGCAGCCTG 0: 1
1: 1
2: 2
3: 36
4: 407
Right 1151237827 17:72734371-72734393 CTCTGTGGACATAGTGGCAATGG 0: 1
1: 1
2: 1
3: 13
4: 162
1151237812_1151237826 21 Left 1151237812 17:72734321-72734343 CCTCGTTCCTTCTCTGCAGCCTG 0: 1
1: 1
2: 2
3: 36
4: 407
Right 1151237826 17:72734365-72734387 CCAGTACTCTGTGGACATAGTGG 0: 1
1: 0
2: 0
3: 8
4: 105
1151237812_1151237818 -4 Left 1151237812 17:72734321-72734343 CCTCGTTCCTTCTCTGCAGCCTG 0: 1
1: 1
2: 2
3: 36
4: 407
Right 1151237818 17:72734340-72734362 CCTGCATTGCAGGGGTCCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 243
1151237812_1151237820 12 Left 1151237812 17:72734321-72734343 CCTCGTTCCTTCTCTGCAGCCTG 0: 1
1: 1
2: 2
3: 36
4: 407
Right 1151237820 17:72734356-72734378 CCCCTGGCCCCAGTACTCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151237812 Original CRISPR CAGGCTGCAGAGAAGGAACG AGG (reversed) Intronic
900507745 1:3038208-3038230 CAGGCTGCTGGGCAGGAAGGGGG - Intergenic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900797303 1:4716108-4716130 CTGGGTGCAGAGAGGAAACGTGG + Intronic
901632163 1:10653291-10653313 CAGGCTGCAGAGCAGAGTCGGGG - Intronic
902137225 1:14319634-14319656 CAGGCTGTCGAGAAGGGAGGAGG - Intergenic
902780214 1:18700163-18700185 CAGTCTCCAGAGAAAGAACCCGG + Intronic
903017196 1:20368867-20368889 GAGGCTGGAGGGAAGGAAAGGGG + Intergenic
904253939 1:29242800-29242822 AAGGCTGCAGAGAAGGGGCCTGG - Intronic
904852117 1:33467195-33467217 CAGGCTTCAGAGACTGAACCTGG + Intergenic
905446311 1:38030364-38030386 CAAGCTCCAGAGCAGGAATGGGG - Intergenic
905858896 1:41333098-41333120 AAAGATGCAGAGAAGGAAGGTGG - Intergenic
906130475 1:43452569-43452591 CAGGTTGCGGAGAAGGACCGAGG - Exonic
906276134 1:44517339-44517361 GAGGCTGGAGAGAGGGAACTGGG - Intronic
908223534 1:62033385-62033407 AAGGCTCCAGAGATGGAACCAGG + Intronic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
909825048 1:80117229-80117251 CAGTCTGCACAGAAAGAAAGAGG + Intergenic
910464126 1:87478301-87478323 CTGGCTGCTGAGATGGAAAGAGG + Intergenic
910869897 1:91823717-91823739 GAGGCTGAAGAGAATGAAAGGGG + Intronic
911520796 1:98927568-98927590 CAGGCTGCAGAGAAGACAGTGGG - Intronic
913199594 1:116485040-116485062 GAGTCAGCAGAGAAGGAAGGCGG + Intergenic
913526456 1:119698048-119698070 CAGGCTACAGGGCAGGAATGAGG - Intronic
915472501 1:156134474-156134496 CAGGCTGCAGACCATGAAGGAGG + Exonic
916192900 1:162196553-162196575 CAGGCTGCAGTGAAGTAGCAGGG + Intronic
916684078 1:167128581-167128603 CAAGCTGCAGAAAAGGAGGGAGG + Exonic
917632367 1:176903063-176903085 CAGGATGGAGAGAAGCAAAGGGG + Intronic
918508280 1:185281698-185281720 CAGGGTGCAGAGAAGAAAGACGG + Intronic
920128038 1:203709298-203709320 CAGCCTCCAGAGAAGGAGGGAGG + Exonic
920441656 1:205984904-205984926 CATGCTGCAGGGAAGGAGAGGGG - Intronic
920866319 1:209756829-209756851 CAGGCTGCAGAGAGAGAACAGGG - Intronic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922729494 1:227942341-227942363 CTGGGTGCAGAGCAGGAAGGAGG + Intronic
923674261 1:236065830-236065852 CAGGCGGCAGAGAAGGGAGGTGG + Intergenic
923772416 1:236949040-236949062 CCTGATGCAGAAAAGGAACGAGG + Intergenic
1063061233 10:2555599-2555621 CAGACTCCAGAGAAAGAACTTGG - Intergenic
1063244021 10:4199946-4199968 CAGGCTGGAGAGAAGGCATGGGG - Intergenic
1063971775 10:11386039-11386061 CTGGCTGAAGAGAAGAAAAGGGG + Intergenic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1065643220 10:27806083-27806105 GAGGCTTCAGAGAAGGAATGAGG - Intergenic
1065811906 10:29450400-29450422 GAGGGTGCACAGAAGGAAAGTGG - Intergenic
1066365042 10:34768733-34768755 CAGAGTGCAGAGAAGAAAAGTGG - Intronic
1067061725 10:43081194-43081216 CAGCCTCCAAAGAAGGAAGGGGG - Intronic
1067524581 10:47030426-47030448 GAGGCTGCAGAGAAGGGGTGAGG - Intergenic
1068138352 10:52973444-52973466 CATGCTTCACAGAAGGAAGGGGG - Intergenic
1069842190 10:71346856-71346878 CAGGCTGCTGCGATGGAAGGGGG + Intronic
1071715240 10:88089104-88089126 CAGGCGGCAGCGCAGGAAAGGGG - Intergenic
1072563344 10:96597139-96597161 CAGGCTGAAGAGATAGAAGGAGG - Intronic
1073186159 10:101616207-101616229 TAGGCAGCAGAGATGGAAGGTGG - Intronic
1074405530 10:113177526-113177548 CAGGCTGGAGAGGAGGAACCTGG - Intergenic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1075954542 10:126510975-126510997 TAGGCTGCAGAGCAGCAATGGGG - Intronic
1076252657 10:128996246-128996268 CACTCTGCAGAGAAGGAAACTGG + Intergenic
1076464120 10:130666679-130666701 CAGGCTGAAAAGAGGGAAAGAGG + Intergenic
1077004227 11:344228-344250 GAAGCTGGAGAGATGGAACGGGG - Intergenic
1077284034 11:1758018-1758040 GAGGCTGCAGAGAGAGAACACGG + Intronic
1077318640 11:1930166-1930188 GAGGCTGCAGACGAGGAAGGAGG + Intronic
1077584903 11:3443822-3443844 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
1079409242 11:20171570-20171592 CAGGCAGTCGAGAAGGAATGGGG - Intergenic
1079450929 11:20599241-20599263 CGGGCTGTAGAGGAGGAAGGAGG - Intergenic
1082044908 11:47717436-47717458 AAGGCTGAAGAGAAGGAAAATGG - Exonic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1082768156 11:57184780-57184802 CAGGATGCAGGGTGGGAACGTGG - Intronic
1083773794 11:64883248-64883270 CAGGCTGCAGAGCAGCAAAGGGG - Intronic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1085267607 11:75246531-75246553 CAGCCTGGACAGAAGGAACCCGG - Intergenic
1085365497 11:75938941-75938963 CAGGCTTCAGAGTAGGGATGGGG - Intronic
1088625959 11:111730971-111730993 CAGGCTGCAGAAAAGGACAGTGG + Intronic
1088684135 11:112270954-112270976 CAGTCTGCAGAGCAGAAACAGGG + Intergenic
1089150777 11:116362393-116362415 CTGGCTGCAGAGAAGGATTGGGG + Intergenic
1089170016 11:116505243-116505265 GAGGCTGCAAAGAAGATACGGGG - Intergenic
1089377409 11:118004390-118004412 CAGGCTGGAGTGAAAGAAGGAGG + Intergenic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1090462546 11:126905144-126905166 CAGCTTGCAGAGGAGGAACGGGG + Intronic
1090498432 11:127237594-127237616 AAGGATGCAGATAAGGAAGGGGG - Intergenic
1091329152 11:134717006-134717028 CAGGCTCCAGTGAAGGATCATGG + Intergenic
1092717289 12:11403946-11403968 CAGGCTGCAGAGCAGTGGCGCGG + Intronic
1094404834 12:30106433-30106455 GAGGCTACAGAGAAGGAAGCTGG - Intergenic
1094659614 12:32455087-32455109 CAGGCAGCCAAGAAGAAACGAGG + Intronic
1096611609 12:52805692-52805714 CAGACTGCAGAGCAGGAGCTGGG + Intergenic
1096795978 12:54077804-54077826 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1098241074 12:68467828-68467850 CAGGCTGGAGAGAAGGCAATGGG + Intergenic
1100814112 12:98368917-98368939 CGGGCAGCAGAGAAGGAAAGGGG + Intergenic
1102073538 12:110041832-110041854 CAGGATGCAGGTGAGGAACGAGG + Exonic
1102295523 12:111733669-111733691 AAGGCTGCAGAGAAGGAGCTGGG + Intronic
1102388852 12:112533762-112533784 CAGGCAGCAGAGACGGATGGAGG + Intergenic
1103993672 12:124815458-124815480 CCGGGTGCAGAGAAAGCACGAGG + Intronic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104896546 12:132167702-132167724 GAGGCTGCAGAGAGGGAGGGTGG - Intergenic
1104951939 12:132445092-132445114 AAGGCTGCAGAGTAGGAACTAGG - Intergenic
1105356151 13:19661824-19661846 CATGCTGCAGAGAAGGTTTGTGG + Exonic
1105707472 13:22977132-22977154 CAGGGTGCAGGGGAGGAACAAGG + Intergenic
1105821597 13:24085598-24085620 CAACATGCAGAGAAGGCACGTGG - Intronic
1105909123 13:24844413-24844435 CAGGCCCCAAAGAAGGAAGGAGG + Intronic
1106156559 13:27163280-27163302 AAGGCTGGAGAGTAGGAAGGGGG - Intronic
1107061374 13:36163055-36163077 TAGGCTGCAGAGAGGGAAGGTGG + Intergenic
1107329456 13:39283391-39283413 CAGGAAGCAGAGAAGCAAAGAGG - Intergenic
1107967351 13:45609276-45609298 CAGGCTGCAGCAAGGGAAGGAGG - Intronic
1108077715 13:46698952-46698974 GGGGCTGCCGGGAAGGAACGAGG - Intronic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108883581 13:55151546-55151568 CATGAGGCAGAGAAGGAAAGAGG - Intergenic
1110978372 13:81867707-81867729 CAGGCGGGAGAGAAAGAAGGAGG - Intergenic
1111133302 13:84004227-84004249 TAGGCTACAAAGAAGAAACGTGG - Intergenic
1112836832 13:103525538-103525560 CAAGTTGCAGAGAAAGAACAAGG + Intergenic
1113265866 13:108617369-108617391 CAGAATGCATAGAAGGAATGAGG - Intronic
1113473112 13:110561064-110561086 AGGGCGGCAGAGCAGGAACGCGG + Intronic
1114458246 14:22871339-22871361 CAGTTTGCAGAGAAGGGGCGGGG + Intergenic
1114654965 14:24310545-24310567 CAGGCTGCAGGGAAGTAAGGAGG + Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115058210 14:29156744-29156766 CAGGCTCCAGGGAAGAGACGGGG - Intergenic
1115436590 14:33381976-33381998 CAGCCTGCAGAGACTGAAAGAGG + Intronic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1116105686 14:40501370-40501392 CAGGCAGGAGTGAAGGAACAAGG + Intergenic
1117746746 14:58877288-58877310 CTGGCTGCAAAGAAAGAACTAGG + Intergenic
1118505102 14:66402715-66402737 TGGGCTGCAGAGAAGAAACATGG - Intergenic
1119425300 14:74531155-74531177 CAGGCGGCAGGGAGGGAAGGAGG + Intronic
1119535332 14:75398405-75398427 CAGCCTGCAGAAAAGGAAAAGGG + Intergenic
1119976773 14:79033351-79033373 CATTCTGCAGAGAATGAACCAGG - Intronic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1123463834 15:20498843-20498865 CAGGCTGCAGCACAGGAAAGGGG + Intergenic
1123654228 15:22501585-22501607 CAGGCTGCAGCACAGGAAAGGGG - Intergenic
1124308135 15:28596781-28596803 CAGGCTGCAGCACAGGAAAGGGG - Intergenic
1125223705 15:37369920-37369942 AAGGGTGCAGAGAATGTACGTGG + Intergenic
1125484335 15:40102018-40102040 CAAGCTGGGGAGAAGGAAAGTGG - Intronic
1125568066 15:40693079-40693101 CAGGCTGGAGTGCAGGGACGTGG - Intergenic
1126289951 15:47063266-47063288 AAAACTGCAGAGAAGGAAAGAGG + Intergenic
1127156268 15:56128639-56128661 CAGGCAACAGACAAGGAAGGGGG + Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1128647428 15:69387824-69387846 CAGCCTGCAGGGAAGGGAAGAGG - Intronic
1130028126 15:80287152-80287174 CAGGCTGCATAGAAGCCAAGAGG + Intergenic
1130870688 15:87969552-87969574 CAGGCTGTAGAGAAGTAGCCTGG - Intronic
1130938797 15:88491080-88491102 CAAGGTGCAGAGAAGGCAGGTGG - Intergenic
1131117531 15:89804153-89804175 CGGGCTGCTGAGAAGGGAGGAGG - Intronic
1132359715 15:101202126-101202148 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132359799 15:101202504-101202526 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1134435592 16:14253487-14253509 CAAGCTGCACCTAAGGAACGTGG + Intronic
1134832420 16:17334362-17334384 CTGGCTGTAGAGAAGGGACTTGG - Intronic
1135884643 16:26294989-26295011 GGGGTTGCAGAGAAGCAACGTGG - Intergenic
1135975245 16:27104451-27104473 CAGGCTCCACAGAGGGAATGAGG - Intergenic
1136366555 16:29811818-29811840 GAGGCTGCAGAGGAGGAGCAGGG - Intronic
1138340171 16:56284013-56284035 CAGCCTGCTGAGATGGAAAGAGG - Intronic
1138979829 16:62254200-62254222 CAGGCTGCTGAAAAGGAGGGAGG - Intergenic
1141207307 16:81942787-81942809 CAGCCTGCAGAGGAGGAACACGG - Intronic
1141394160 16:83690293-83690315 AAGGAAGCAGAGAAGGAAGGAGG + Intronic
1141677537 16:85525423-85525445 CAGGATGCTGAGAAGGAGCGAGG + Intergenic
1141681176 16:85544861-85544883 CAGGCAGCAGAACAGGACCGCGG + Intergenic
1142029565 16:87831801-87831823 CCGCCTGCAGAGAGGGAACTAGG - Exonic
1142286643 16:89174154-89174176 CGGGCTTCAGAGAAGGGATGTGG - Intronic
1142509346 17:384789-384811 CAGGCTGCAGAGGATGGAGGGGG + Intronic
1142909304 17:3073435-3073457 CATCCTGTAGAGCAGGAACGTGG - Intergenic
1142925256 17:3230803-3230825 CATCCTGTAGAGCAGGAACGTGG + Intergenic
1143350159 17:6282185-6282207 CAGGCAGCAGAGAAAGTATGGGG + Intergenic
1143568886 17:7741983-7742005 CAGGCTGCAGAGGAGGAATAGGG + Intronic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1143852855 17:9825762-9825784 CAGGCTGAGGAGAAAGAACAAGG - Exonic
1143867887 17:9937355-9937377 CAGGCTGGAGAGATGGAAGCCGG + Intronic
1145786435 17:27596978-27597000 CAGGATGGAGAGGAGGAGCGTGG + Intronic
1146943176 17:36857997-36858019 CTCACTCCAGAGAAGGAACGCGG - Intergenic
1146949831 17:36898239-36898261 CTGGGTGCAGACAAGGAACCAGG + Intergenic
1147045975 17:37752479-37752501 CTGGTTGCAGAGCAGGAGCGAGG + Intergenic
1147159815 17:38563264-38563286 CACCCTGCAGAGGAGGAGCGTGG + Intronic
1147791827 17:43018520-43018542 CAGGCTGCAGGGAAGGGGCCTGG + Intronic
1148073976 17:44925053-44925075 CAGGCAGTAGAGGAGGAATGAGG - Intronic
1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG + Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150205269 17:63400037-63400059 CAGGCTGAGGGGAAGGAACTGGG + Intronic
1150445404 17:65224343-65224365 CAGGCTGGGGAGAAGGAAACAGG - Intronic
1150633597 17:66897610-66897632 CATCTTGCAGAGAAGGAAGGAGG - Intergenic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151373386 17:73665272-73665294 CAGGCTGCAAATATGGAAGGCGG - Intergenic
1151566290 17:74900475-74900497 CAGGCTCAAGAGAATGAAGGAGG + Intergenic
1151578382 17:74963989-74964011 CAGGCTGCAGAGGAGGGTCAGGG + Intronic
1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG + Intronic
1152467346 17:80473815-80473837 GTGGCTGCAGAGGAGGAACGAGG + Intronic
1152477786 17:80529347-80529369 ATGGCTGCAGAGGAGGAAGGCGG - Intergenic
1153467629 18:5406713-5406735 CACCCTGTAGAGAAGGAAGGCGG + Intronic
1153934032 18:9904899-9904921 GAGGCTGCAGGGAAGGAGAGGGG - Intergenic
1155610554 18:27662576-27662598 CAGGCTGCAAACAAAGAACTGGG + Intergenic
1156330207 18:36114412-36114434 CAGGCTGCTGAGAATCAAAGTGG + Exonic
1156759001 18:40564163-40564185 CAGACAGCAGAGAAGGAAGCTGG - Intergenic
1156931175 18:42645647-42645669 TAGGCTGCAAAGAAAGAACTGGG - Intergenic
1157108157 18:44794096-44794118 CAGCCTGCAGAGTATGAACAGGG + Intronic
1160462296 18:79048335-79048357 TAGGCTGCAGAGAAGGCCAGGGG + Intergenic
1160517909 18:79488628-79488650 GAGGCTGCAGAGCAGGGACATGG - Intronic
1160788787 19:913287-913309 CCGGCTGCCGGGAACGAACGCGG + Intergenic
1165268248 19:34679488-34679510 GAGGAGGCAGAGAAGGAAGGTGG - Intronic
1165269320 19:34691424-34691446 CAGACTGCAAAGCAGGAAGGGGG - Intergenic
1165274453 19:34735729-34735751 GAGGAGGCAGAGAAGGAAGGTGG - Intronic
1166554087 19:43686596-43686618 CAGGCAGGAGAGAAGGAAGCAGG - Intergenic
1166595050 19:44039611-44039633 CTGGCCTCAGAGAAGGAACTAGG - Intergenic
1166705992 19:44908417-44908439 CAAGAGGGAGAGAAGGAACGGGG - Intronic
1167024431 19:46904907-46904929 CTGGCTGGAGAACAGGAACGCGG - Intergenic
1167212648 19:48143060-48143082 CATGCTGCTGAGAAGGACCAGGG + Intronic
1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG + Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167672071 19:50859177-50859199 CTGGCTGGAGTGAAGGATCGGGG + Intronic
1168240075 19:55084464-55084486 CAGACTGGAGGGAAGCAACGTGG + Intronic
926053778 2:9761732-9761754 AGGGCTGCAGAGAAAGAACTTGG - Intergenic
927323254 2:21772808-21772830 CATGGAGCAGAGAAGGAAGGGGG - Intergenic
928436288 2:31256759-31256781 GAAGCTGCAGAGAAGGGAAGAGG - Intronic
930036782 2:47090679-47090701 CATGCTGCTGTGAGGGAACGGGG - Intronic
930243876 2:48963609-48963631 CAGGTTGCACATAAGGAACCTGG + Exonic
930257837 2:49112020-49112042 CAAGCTGCAGAGTAGCAACTAGG + Intronic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
932199880 2:69816110-69816132 GAGGCTGGAGAGAAGAAATGGGG + Exonic
932283181 2:70512359-70512381 CAGTCTGCAGAGGAGGGAGGTGG - Intronic
932361504 2:71111780-71111802 CAGACTGCAGTGCAGGAAGGGGG - Intronic
932886587 2:75554429-75554451 CAGGCTGGGGAGAAGGAAAGGGG + Intronic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
934747799 2:96770903-96770925 CGGGCTGGGGAGAAGGAACCAGG - Intronic
937258354 2:120570155-120570177 CAGGCTGCTGAGAAGGCCCTGGG + Intergenic
937315980 2:120932371-120932393 CAGGATCCTGAGAGGGAACGGGG - Intronic
937930536 2:127201624-127201646 AAGGCTGCAGAGGAGGACCCTGG + Intronic
937966213 2:127513335-127513357 CAGGCTGCACATGAGGTACGGGG + Intronic
937998868 2:127716100-127716122 GAGGCTATACAGAAGGAACGTGG - Intronic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
938376218 2:130808403-130808425 CAGGGTGCAGAGAAGAGAGGTGG - Intergenic
939049262 2:137288147-137288169 CAGGCAGCAGTGAAAGAACAAGG + Intronic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
940024312 2:149189166-149189188 CAGGCTGCTGAGTAGGCAAGAGG - Intronic
941771549 2:169350791-169350813 CAGGCTGCTGAAAAGGACCCAGG - Intronic
944356544 2:198796025-198796047 CAGGCTTCAGATTAGGAACAAGG - Intergenic
944397881 2:199290034-199290056 CAGGCTGCAGTGAGGTTACGGGG - Intronic
944970302 2:204985178-204985200 CAGGCAGGAGGGAAGGAAGGAGG - Intronic
946033553 2:216724120-216724142 CAGGGTGCAGAGAAGTAGCCAGG + Intergenic
946490865 2:220147658-220147680 CAGCCTGCTGAGAAGGAATCGGG - Intergenic
946607482 2:221421443-221421465 CAGGCAGGAGAGAGGGAACATGG + Intronic
947702074 2:232242867-232242889 CAGGCAGCAGAAAAGGAAACGGG - Intronic
947917076 2:233839593-233839615 CAGGCACCACAGAAGGAACAAGG + Intronic
947954875 2:234180078-234180100 CAGGCTGGAGTGAAGTAATGTGG - Intergenic
948212749 2:236207158-236207180 CAGGATGCAGAGCAGGACCCAGG + Intronic
948461604 2:238132423-238132445 AAGGCTGGAGAGCAGGGACGTGG + Exonic
948665401 2:239531659-239531681 CAGGGGGCAGAGAAGGGACCTGG - Intergenic
1169503936 20:6188153-6188175 CAGGCTGCAGTGAAGTGGCGCGG + Intergenic
1170373194 20:15672041-15672063 CAGGATGCTGAGAAGGATCCAGG + Intronic
1170444000 20:16406124-16406146 AAGGCTGAAGAGAAGGATCTAGG + Intronic
1172974327 20:38894887-38894909 CATGCTGCAGTGATGGCACGTGG - Intronic
1173665790 20:44762230-44762252 CAGGCTGCAGAGCAGGTGAGCGG - Intronic
1173851755 20:46222867-46222889 CAGGGAGCAGAGCCGGAACGGGG - Intronic
1174139114 20:48400452-48400474 AAGGCTGCAGAGACGGGAGGAGG + Intergenic
1175462613 20:59163985-59164007 CTGCCTGCAGAGTAGGAACTGGG + Intergenic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175922203 20:62455544-62455566 CAGGGTGCAGAGAAGGGGCCTGG - Intergenic
1177802660 21:25843115-25843137 CAGGCAGCAGAAAGGGAATGTGG - Intergenic
1178506533 21:33167432-33167454 CAGGCTGCTGAGAAGCACTGGGG - Intronic
1179006837 21:37522777-37522799 CAGGCTTTTGAGAAGGAAGGAGG - Intergenic
1179052609 21:37901010-37901032 CAGGAAGGAGAGAAGGAAGGGGG - Intronic
1179194990 21:39156381-39156403 CAGGCTGGAGAGCAGTAGCGTGG + Intergenic
1179405149 21:41119676-41119698 GAGGCTGCGGAGGAGGAACATGG - Intergenic
1179555699 21:42174233-42174255 CAGGCTGGAGAGGAGGCAGGTGG + Intergenic
1179823683 21:43952021-43952043 CATGCTGCAGCGAAGGACCTGGG + Intronic
1180031507 21:45211805-45211827 CAGCCTGCAAAGAGGGAACTAGG - Intronic
1180713472 22:17855890-17855912 CAGGCTGCAGAGAATGATGAAGG + Intronic
1180854995 22:19040101-19040123 CAGGCTGCAGAGCAGGGTGGGGG - Intronic
1180958285 22:19750839-19750861 GAGGCTGCCGTGGAGGAACGTGG - Intergenic
1182009603 22:26989549-26989571 CAGGCTTCAGGGAAGGAGCCAGG - Intergenic
1182028432 22:27138307-27138329 CAGGCTGCAGAGAGGGGCCTCGG - Intergenic
1183001438 22:34862754-34862776 CAGGCTGGTGAAAAGGAAGGAGG - Intergenic
1184090164 22:42288949-42288971 CGAGGTGCAGAGAAGGAATGAGG - Intronic
1184190714 22:42892618-42892640 CAGGCTGTGGAGCAGGCACGTGG - Intronic
1184265528 22:43343856-43343878 GAGGCAGCAGCGAAGGAACCGGG + Intergenic
1184334838 22:43847076-43847098 CAGGCTGGAGAGAAGGGCCACGG - Intronic
1184782728 22:46657205-46657227 CAGGCCTCTGAGAAGGACCGAGG + Intronic
949731050 3:7113370-7113392 CAGGATGTAGATAAGGAACGAGG - Intronic
950318355 3:12025785-12025807 GAGGCAGCAGAGAAGGCACAGGG - Intronic
950464763 3:13146877-13146899 CGGGCTGCATAAAAGAAACGTGG + Intergenic
950723657 3:14901942-14901964 CAGGGTTCAGAGAAGGGAGGTGG + Intronic
951292583 3:20891446-20891468 GAGGCTGGAGAGAAGAAATGGGG + Intergenic
952085124 3:29811576-29811598 CATGCTGAAGAGAAGGCATGAGG + Intronic
954217066 3:49130576-49130598 CAGACTGCAGAGGAGGATTGAGG + Intronic
955977752 3:64494385-64494407 CAGGCTGTAGAGATGGACCAGGG - Intergenic
956289661 3:67648182-67648204 CAGGTTGCAGAGAAAGAACATGG + Intronic
957532675 3:81460646-81460668 CAGGCTGAAATGAAGGAAAGCGG + Intergenic
960281284 3:115784167-115784189 CGGCCTGCAGAGAGGGAGCGCGG - Intergenic
960948762 3:122984776-122984798 AAAGCTTCAGAGAAGGAAAGAGG + Intronic
962733864 3:138306755-138306777 CAGGTGGCAGAGGAGGAACATGG + Intronic
964038045 3:152222760-152222782 CAAGCTGCAGCAAAGGAATGAGG - Intergenic
965709512 3:171543215-171543237 CAGGCTGCAGGGCAGGAAAAAGG - Intergenic
967647117 3:191938960-191938982 CAGGCTGTAGAACAGGAAGGGGG - Intergenic
967787205 3:193510122-193510144 CAAGTTGCAGAGGAGGAGCGGGG + Intronic
968199534 3:196740208-196740230 CAGGCCACGGAGAAGGAAGGAGG - Intronic
969000098 4:3973665-3973687 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
969534501 4:7747537-7747559 CAGGCTGCAGAGAAGCTGAGTGG + Intergenic
969813812 4:9671138-9671160 CAGGCTGCCTAGAAGGGACGCGG - Intergenic
971454774 4:26834088-26834110 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
972473598 4:39430541-39430563 CAGGTTGGAGACAAGGAAAGAGG + Intronic
972736423 4:41846102-41846124 CAGGAGGAAGAGAAGGAAGGGGG - Intergenic
972800422 4:42469399-42469421 AAGGCTGTAGGGAAGGAATGTGG + Intronic
972817330 4:42657785-42657807 CAGGCTGCAGAGCCTGAACTAGG - Intergenic
973636254 4:52863684-52863706 CAGCCAGCAGAGAAGGAGAGGGG - Intronic
977495390 4:97769059-97769081 AAAGCTGCAGAGAGGGAATGAGG + Intronic
977914347 4:102574596-102574618 CAGGCTGCAGCACAGGAAGGAGG - Intronic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
980801934 4:137762935-137762957 CAGACTGCAGAGAATGCAGGTGG + Intergenic
981500494 4:145446127-145446149 CAGTCTGCAGTGCAGGAATGAGG + Intergenic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
984279507 4:177652305-177652327 CAGTCTACAGAGAAAGAACAAGG + Intergenic
985286019 4:188336975-188336997 CAGCCTTCAGAGCAGGAATGAGG - Intergenic
985548788 5:523040-523062 GAGGCTGCGGAGAAGGGAGGAGG + Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
990777399 5:59317487-59317509 CATGCTGCAGAGATGTAAAGTGG - Intronic
993446699 5:88021327-88021349 CAGCCTGCAGGGAGGAAACGGGG + Intergenic
994092058 5:95818278-95818300 CAGGCTGTACAGACGGCACGGGG + Intronic
995609196 5:113890928-113890950 CAGGGTGTAGAGAAGGATCAAGG - Intergenic
995657560 5:114444033-114444055 TAGGCTGGAGACAAGGAAAGAGG + Intronic
996271442 5:121609324-121609346 GTGGCAGCAGAGAAGGAATGGGG + Intergenic
997368723 5:133342321-133342343 CAGGTTGCAGAGAAGGGGCAGGG + Intronic
997372460 5:133370667-133370689 CCAGCTGGAGAGAAGGAATGAGG + Intronic
997583520 5:135031496-135031518 CCTACTGCAGAGAAGGAGCGCGG - Exonic
998040222 5:138946848-138946870 CAGGCTCCAGGGCAGGAACCTGG - Exonic
998726602 5:145024400-145024422 CAGGCTGGAGACAAGGACTGGGG - Intergenic
999329381 5:150662315-150662337 CAGGAGGAAGAGAAGGGACGAGG + Intronic
1001664941 5:173424759-173424781 CAGGCTGGTGAGAAGGAAGATGG - Intergenic
1001948297 5:175797741-175797763 CAGACGGCAGAGAAGGCAGGGGG + Intronic
1002202358 5:177536976-177536998 CATGCTGCAGAAAAGGCATGGGG - Intronic
1002283539 5:178147514-178147536 AAAGCTGCAGACAAGGAACAGGG - Exonic
1003341764 6:5228319-5228341 CAGGCTGCAGTGCAGTAATGCGG + Intronic
1004308433 6:14522091-14522113 CAGGCTGCAGTGCAGTCACGCGG - Intergenic
1005083452 6:21980577-21980599 CAGGCTGCAGAACAGGAAGAAGG - Intergenic
1005083529 6:21980967-21980989 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083622 6:21981545-21981567 CAGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005272941 6:24185760-24185782 CAGTCTGCAAAGAAGGAAAAGGG + Intronic
1005425589 6:25699655-25699677 CAGGGTGCAGAGAACAAAAGGGG + Intronic
1005882046 6:30069378-30069400 CAGGCAGAAGAGAGGGAAGGAGG - Exonic
1006298956 6:33183299-33183321 CAGGAAGCAGTGAAGGAAAGAGG + Intronic
1006336206 6:33421825-33421847 CAGGCTGCAGCCAAGGGAGGCGG - Intronic
1006427609 6:33976099-33976121 CAGGCTGGGGAGGGGGAACGTGG + Intergenic
1007114352 6:39332924-39332946 CAGGCTGCAGCCCAGGAAGGGGG - Exonic
1007263186 6:40577990-40578012 CAGGGGGCACAGAAGGGACGGGG - Intronic
1007431165 6:41778126-41778148 CAGTCTGCAGAGAAGTCACCCGG + Exonic
1007661589 6:43490086-43490108 CAGGCTGCGGGGAAGGATGGAGG - Intronic
1007835522 6:44671177-44671199 GAGGCTGCAGAGAAGGAAGGTGG - Intergenic
1008129859 6:47708563-47708585 CAGGAGGCAGAAAAGGAAAGAGG + Intronic
1011062379 6:83285512-83285534 CATGCTGTAGAGAAGGAAGAAGG + Intronic
1011131893 6:84060253-84060275 CAGCCTTCAGAGAAGGCAGGTGG - Intronic
1011838019 6:91457840-91457862 CAGGCTTCTGAGAAGGGAAGAGG + Intergenic
1012232285 6:96774378-96774400 GAGGCTGCAGAGAAACAAAGTGG + Intergenic
1012334796 6:98042035-98042057 CAGACTGCAGAGAAAGGATGCGG - Intergenic
1012949517 6:105503253-105503275 CAGGCTGCAGAGGAGGCTGGAGG - Intergenic
1016996237 6:149964069-149964091 CGGGAGGCACAGAAGGAACGCGG - Exonic
1017315333 6:153024493-153024515 TTGGCTGCAGAGACAGAACGGGG + Exonic
1017543683 6:155428490-155428512 CAGGCTGCATAGAAGTAACCAGG + Intronic
1017599899 6:156069309-156069331 GAGGCTGGAGAGAAAGAAAGAGG + Intergenic
1017806966 6:157954489-157954511 TAGGCTGCAGAAAAGGAAACCGG - Intergenic
1018774956 6:167006056-167006078 CATGTTGCAGATAAGGAACCTGG - Intronic
1018789313 6:167134480-167134502 CAGGCATCAGGGAAGGAATGGGG + Intronic
1018918292 6:168152133-168152155 CAAGCAACAGAGCAGGAACGAGG - Intergenic
1019063083 6:169271232-169271254 CAGGCCCCAGAGCAGGAAGGCGG + Intergenic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1021922107 7:25495781-25495803 CAAGCTGCAGAGACAGAGCGAGG + Intergenic
1022029270 7:26477544-26477566 GAGACTGCAGAGGAGGAAGGAGG + Intergenic
1022233607 7:28439551-28439573 CAGTTTGCAGAGGAGGAACCTGG + Intronic
1022237087 7:28472762-28472784 CAGGCTGCAGAGAGAGACCTTGG - Intronic
1022802082 7:33786357-33786379 CAGGCTGCTGAGATGGATGGAGG + Intergenic
1023528432 7:41129430-41129452 CAGGCTACAGGGATGGAAGGTGG - Intergenic
1023728037 7:43164220-43164242 GAGGCAGCAGAGAAGGCAGGAGG + Intronic
1025832201 7:65062169-65062191 CAGGCTGCAGAGCAGGGATGGGG + Intergenic
1025919879 7:65901598-65901620 CAGGCTGCAGAGCAGGGATGGGG + Intronic
1026034975 7:66824333-66824355 CAGCCTGCAGGAAAGGAACCTGG + Intergenic
1026171169 7:67955174-67955196 CAGGCAGCAGAGAAGGACCTGGG + Intergenic
1026336148 7:69395604-69395626 CATGCTGCAGAGAGGCAATGTGG + Intergenic
1026893359 7:73996094-73996116 CAGGTTGCAGAGGAGAAAAGAGG + Intergenic
1026984607 7:74546931-74546953 CAGCCTGCAGGAAAGGAACCTGG - Intronic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1028964598 7:96787908-96787930 TAGGCTGCAGAGGAGGAAAGTGG - Intergenic
1029644311 7:101843711-101843733 CAGGCTGAAGGGAGGAAACGAGG - Intronic
1029692364 7:102190818-102190840 CAGCCTGCAGAGATGGGAGGTGG - Intronic
1029924854 7:104304626-104304648 GAGCCTGCAGAGAAGGCTCGAGG + Intergenic
1032153589 7:129450753-129450775 TAGGCTGCAGAGAAGGCCCTTGG - Intronic
1032192156 7:129771505-129771527 CAGGCTGCAGGGGAGGCATGGGG - Intergenic
1032469099 7:132165078-132165100 CAGGCTGCAGAGAATGAACGAGG + Intronic
1032550420 7:132779461-132779483 CAGGCTGCAGAGCAGGGGCTGGG - Intergenic
1032580142 7:133096545-133096567 AAGGCTGCAGAGAAGGTCCCAGG + Intergenic
1034495256 7:151417038-151417060 CAGACCACAGAGCAGGAACGGGG + Intergenic
1034980422 7:155472286-155472308 CACGCAGCAGAGAAGAAACAGGG + Intergenic
1035389825 7:158496932-158496954 GAGGCTGCAGAGAAGGGGAGGGG - Intronic
1035428139 7:158795911-158795933 AAGGCTGCACAGGAGGCACGGGG + Intronic
1036377140 8:8210291-8210313 CAGGCTGCCTGGAAGGGACGCGG - Intergenic
1036386352 8:8285180-8285202 CATGATGAAGAGAAGGAATGGGG - Intergenic
1036813004 8:11880410-11880432 CATGCTGCAGAGAATAAACCTGG - Intergenic
1036852409 8:12212858-12212880 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
1036873777 8:12455381-12455403 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
1039426925 8:37493737-37493759 AAGGCTGGAGAGAGGGAACATGG - Intergenic
1040445765 8:47491973-47491995 CAGGCAGTACAGGAGGAACGAGG + Intronic
1042617663 8:70668499-70668521 CAGGCTGCAGAGAACCAATTTGG + Intronic
1043769743 8:84183416-84183438 CAGGCAGCGGGGAAGGACCGAGG - Intronic
1047329853 8:123876983-123877005 CAGGATGCAGAGAAGCACAGAGG - Intronic
1048054254 8:130848350-130848372 CAGGCTGCAGAGAAGCAGCCAGG - Intronic
1048332435 8:133479894-133479916 CTGGCTGCAGGGAAGAAACCAGG + Intronic
1048841467 8:138570276-138570298 CAGGCTGAAGTGAAGTAGCGTGG - Intergenic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1049020920 8:139957253-139957275 AAGGCTGCAGGGCAGGTACGCGG - Intronic
1049428789 8:142549736-142549758 CAGGCTGCAGAGCAGGGCTGTGG - Intergenic
1049443112 8:142618145-142618167 CCGGCAGCAGAGAAGGAATGAGG + Intergenic
1051209628 9:14728046-14728068 CAGGGTGAAAAGAAGGACCGTGG - Intergenic
1052370852 9:27663064-27663086 GAGGGTGCAGAGATGGAAAGTGG - Intergenic
1053300117 9:36942985-36943007 CTGGGTGCAGAGAAGGAGAGCGG - Intronic
1053785591 9:41650480-41650502 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054174310 9:61864446-61864468 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054449168 9:65393491-65393513 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054663228 9:67716345-67716367 CAGGCCTCAGAGAAGGAGGGCGG - Intergenic
1054802417 9:69363666-69363688 GAGGCTGCAGAGAAGGAACCAGG + Intronic
1056848857 9:90063885-90063907 CAGCCTGCAGAGAAAGAAGAGGG + Intergenic
1057596595 9:96419392-96419414 CAGGCTGCAGAGGAAGGACCGGG + Intergenic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1057770799 9:97966154-97966176 TAGGCTGCTGAAAAGGAATGGGG - Intergenic
1057809986 9:98250360-98250382 CAGGCTGCAGAGAAGGGGATGGG + Intronic
1057843149 9:98502358-98502380 CAGGCTTCAGAGCAGGGAGGAGG - Intronic
1057996530 9:99824761-99824783 CAGGCCTCAGGGAAGGAACTGGG - Intronic
1058037906 9:100273247-100273269 GAGGCTGCAGTGAAGGACAGAGG + Intronic
1059374394 9:113871010-113871032 CAGCCTTGAGAGAAGGGACGTGG - Intergenic
1059390439 9:113996457-113996479 CAGGCTTCTGAGAAAGAATGTGG - Intronic
1059651292 9:116318660-116318682 CTTGCTGCAGAGGAGGAACACGG - Intronic
1060300188 9:122370591-122370613 CAGTCTGCAGAGAAGAAAGGGGG - Intronic
1060556753 9:124511903-124511925 CAGGCTGCAGAGTGGAAAGGTGG + Intergenic
1061231263 9:129317180-129317202 AAGTGTGCAGAGAAGGAACAAGG - Intergenic
1061287673 9:129633375-129633397 AAGGGTGCAGAGAGGGAACATGG - Intronic
1061707141 9:132461854-132461876 CAGGCTCTAGAGCAGAAACGGGG - Intronic
1062065209 9:134523077-134523099 CACGCTGCAGAGAGGGAGCCGGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1185823231 X:3224874-3224896 CAGGGTTCACAGAAGGAATGAGG + Intergenic
1186308945 X:8296595-8296617 AAGGCTGGATAGAAAGAACGGGG - Intergenic
1186704267 X:12125547-12125569 AAGGCTCCAGATAAGGACCGGGG - Intergenic
1188074571 X:25759375-25759397 AAGGGTTCAGAGAAGGAGCGAGG + Intergenic
1188270660 X:28136437-28136459 CAGGCTGGAGTGAAGCAGCGTGG + Intergenic
1188535086 X:31188146-31188168 CAGACTGAAGACAAGGTACGGGG + Intronic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1189658545 X:43273520-43273542 TAGGCGGGAGAGAAGGAATGGGG - Intergenic
1191604071 X:63042616-63042638 CAGCCTGCAGAAAAGGAATAGGG + Intergenic
1192163001 X:68802657-68802679 TAGGCTGCAGATATGGAACTGGG + Intergenic
1192300404 X:69895364-69895386 AAGGCTGCAAAGAAGGGATGGGG - Intronic
1192300497 X:69896442-69896464 AAGGCTGCAAAGAAGGGATGGGG + Intronic
1195334135 X:103832494-103832516 CAGGCTGCAGAGGAGCTAAGTGG - Intergenic
1196653880 X:118196966-118196988 CAGGCTGGAAGGAAGGAAAGAGG + Intergenic
1197835585 X:130690501-130690523 CAGACTGCAAAGAAAGAAAGTGG + Intronic
1198701772 X:139404817-139404839 CATTCTACAGAGAAGGAAAGAGG + Intergenic
1199044816 X:143156835-143156857 CATGCTGCTGAGAGGGAAAGGGG - Intergenic
1199418573 X:147616118-147616140 CAGGCAGCAGAGAAACAAAGAGG + Intergenic
1199482026 X:148308266-148308288 AAGTCTGCAGAGATGGAACGGGG + Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199737345 X:150696226-150696248 CAGACTACAGAGAAGGGATGGGG + Intronic
1200337602 X:155366566-155366588 AAGGCTGCAGAAAAGTCACGAGG - Intergenic
1200348868 X:155474661-155474683 AAGGCTGCAGAAAAGTCACGAGG + Intergenic
1200716865 Y:6556739-6556761 CAGTGTGCAGAGAAGAAAAGGGG - Intergenic
1201235665 Y:11908466-11908488 AAATCTGCAGAGAAGGAAGGTGG + Intergenic
1201579039 Y:15492075-15492097 CAGGCAGGAGAGCAGGAAGGTGG + Intergenic