ID: 1151243433

View in Genome Browser
Species Human (GRCh38)
Location 17:72776004-72776026
Sequence AGGGAGAGGGAACATGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 536}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151243433_1151243447 17 Left 1151243433 17:72776004-72776026 CCTGCCACATGTTCCCTCTCCCT 0: 1
1: 0
2: 4
3: 57
4: 536
Right 1151243447 17:72776044-72776066 GAAGAATTGGGGAATACAGATGG 0: 1
1: 0
2: 1
3: 33
4: 331
1151243433_1151243443 4 Left 1151243433 17:72776004-72776026 CCTGCCACATGTTCCCTCTCCCT 0: 1
1: 0
2: 4
3: 57
4: 536
Right 1151243443 17:72776031-72776053 CAGGCTGGTCCAGGAAGAATTGG 0: 1
1: 0
2: 2
3: 23
4: 230
1151243433_1151243444 5 Left 1151243433 17:72776004-72776026 CCTGCCACATGTTCCCTCTCCCT 0: 1
1: 0
2: 4
3: 57
4: 536
Right 1151243444 17:72776032-72776054 AGGCTGGTCCAGGAAGAATTGGG 0: 1
1: 0
2: 3
3: 15
4: 214
1151243433_1151243440 -5 Left 1151243433 17:72776004-72776026 CCTGCCACATGTTCCCTCTCCCT 0: 1
1: 0
2: 4
3: 57
4: 536
Right 1151243440 17:72776022-72776044 TCCCTGGATCAGGCTGGTCCAGG 0: 1
1: 0
2: 1
3: 28
4: 226
1151243433_1151243445 6 Left 1151243433 17:72776004-72776026 CCTGCCACATGTTCCCTCTCCCT 0: 1
1: 0
2: 4
3: 57
4: 536
Right 1151243445 17:72776033-72776055 GGCTGGTCCAGGAAGAATTGGGG 0: 1
1: 0
2: 1
3: 23
4: 221
1151243433_1151243448 18 Left 1151243433 17:72776004-72776026 CCTGCCACATGTTCCCTCTCCCT 0: 1
1: 0
2: 4
3: 57
4: 536
Right 1151243448 17:72776045-72776067 AAGAATTGGGGAATACAGATGGG 0: 1
1: 0
2: 1
3: 32
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151243433 Original CRISPR AGGGAGAGGGAACATGTGGC AGG (reversed) Intronic
900088249 1:908732-908754 GGGGAGAGGGGACAAGTGGGAGG + Intergenic
900898602 1:5501813-5501835 AAGGAGAGGGTTCATGTGGCTGG - Intergenic
901053535 1:6437876-6437898 AGGGAGAGGGCACACGTGACAGG + Intronic
901637793 1:10678399-10678421 AGGGAGAGGCAGCAGGTGGGTGG + Intronic
902418285 1:16256108-16256130 AGGGAAAGGTAGCAGGTGGCAGG - Intronic
902480740 1:16710268-16710290 AGGGAGAGGGCACACGTGACAGG - Intergenic
902751404 1:18514033-18514055 AGAGAGAGAGATCATGTGGAGGG - Intergenic
903517527 1:23921903-23921925 AAGCAGAGGGAACATGGGCCAGG - Intergenic
903649017 1:24911865-24911887 AGGGCAAGGGAGCATGTGGTGGG - Intronic
903793183 1:25908324-25908346 AGGGAGAAAGAAAATGTGGGGGG - Intergenic
904342902 1:29849318-29849340 AGGTAGAGGGAACACCTGGGGGG + Intergenic
904420855 1:30390281-30390303 AGGGAGAGGGAGCATTGGGGAGG + Intergenic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
905657059 1:39691904-39691926 TGGGAGAGGGAGGAGGTGGCTGG + Intergenic
905863306 1:41364106-41364128 GGGAAGAGGGAACATGAGGCTGG + Intronic
905967720 1:42113248-42113270 AGAGAGGTGGACCATGTGGCTGG + Intergenic
906527879 1:46506963-46506985 AGGGAGAGGGGCCATGAGGCAGG - Intergenic
907937708 1:59057568-59057590 AGGGAGTGGGAACAGGTTGCTGG - Intergenic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
910023980 1:82626979-82627001 AGGGAGAGGGAAAATGTCAGAGG + Intergenic
910803087 1:91164667-91164689 AGGGAGATGGCAGCTGTGGCGGG + Intergenic
911042008 1:93598659-93598681 AGGGACAGGGAGCAGATGGCAGG - Intronic
911735253 1:101329812-101329834 AATTAAAGGGAACATGTGGCTGG - Intergenic
912703404 1:111895048-111895070 AGGGAGAGGAAGCATGAGGGAGG + Intronic
913133455 1:115863960-115863982 AGGGAGTGGGAGTCTGTGGCTGG + Intergenic
913162342 1:116155622-116155644 TAGGAGAGGCAACATGGGGCAGG + Intergenic
915019893 1:152769215-152769237 AGGGAGAGGAAATATGAGACAGG + Intronic
915688303 1:157659772-157659794 TGGGAAAGGAAACTTGTGGCAGG - Intergenic
916087221 1:161280227-161280249 AAGCAGAGGGAACATTTGGAGGG - Intronic
916532757 1:165673806-165673828 AGGGAGAGGGGAAATGTCACAGG + Intronic
916822621 1:168414326-168414348 AGGGAGAGTGAAGAGGTGCCTGG + Intergenic
917387267 1:174491044-174491066 AGGGAGATAGAGCATGAGGCAGG - Intronic
917634102 1:176918457-176918479 AATGAGATGGAACATGTTGCCGG - Intronic
917654433 1:177112314-177112336 AGGAAGAGGGAATATGTTGAAGG + Intronic
918296411 1:183161274-183161296 AGGGAGAGAGAACATGTTTGGGG + Intergenic
918912295 1:190590549-190590571 AGGGTGAGGGAACCTAAGGCAGG + Intergenic
919742800 1:200990856-200990878 AGGGGGTGGGAATATGGGGCAGG - Intronic
920096911 1:203492340-203492362 AGGCAGATGGCACATTTGGCGGG - Intergenic
920308282 1:205032756-205032778 AGGCAGAAGGAACGTGAGGCTGG - Intergenic
920308542 1:205034274-205034296 ATGGAGAGGGAGCATGAGCCAGG - Intergenic
920836269 1:209513899-209513921 AGGGCGAAGGCAGATGTGGCAGG - Intergenic
921220252 1:212968627-212968649 AAGGAGATGAAACATGTGCCTGG + Intronic
922195568 1:223357057-223357079 AGGGTGAGTAAACAAGTGGCTGG - Intronic
923979793 1:239309279-239309301 AGGGAGAGAAAACATGGAGCAGG + Intergenic
924461864 1:244266787-244266809 AGGAAGGGAGAACAGGTGGCAGG + Intergenic
1063365200 10:5486369-5486391 AGGGAGAGGGTAGCTGGGGCAGG + Intergenic
1063543522 10:6958076-6958098 TGGGAGAGGGACCATGGGGTTGG - Intergenic
1063982879 10:11470140-11470162 AGGAAGAAGGAAGACGTGGCGGG + Intronic
1063995674 10:11616424-11616446 ATGGAGAGGCCACATGTAGCTGG + Intergenic
1064118815 10:12601958-12601980 AGGGCAAGGGATCCTGTGGCAGG + Intronic
1064124100 10:12644208-12644230 AGTGAGAGGGACCATAGGGCGGG - Intronic
1065130618 10:22616201-22616223 AGGGGGAGCTGACATGTGGCAGG + Intronic
1065175253 10:23069200-23069222 AGGGAGACAGAATCTGTGGCTGG - Intergenic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1068229395 10:54151844-54151866 AAGGAGAGGGAACATTTTGGAGG + Intronic
1068781631 10:60925085-60925107 AGGGAGAGAGAGCATGGGGTAGG - Intronic
1069176364 10:65293774-65293796 AAGGAAAGGGAAAATGAGGCAGG - Intergenic
1069662402 10:70132396-70132418 GGGAAGAGGGAACACGGGGCGGG - Intronic
1069863181 10:71483867-71483889 GGGGAGAGTGAACATGTGTGTGG - Intronic
1070737102 10:78870635-78870657 AGGGAGTGGGCACCAGTGGCAGG + Intergenic
1071112001 10:82170316-82170338 AGAGAGAGCAAGCATGTGGCCGG + Intronic
1071499694 10:86194690-86194712 GGGGAGTGGGAAGATGTGGAAGG - Intronic
1071504427 10:86224080-86224102 AGTTGGAGGGAACATGTGCCTGG - Intronic
1071531335 10:86392170-86392192 AGAGAGAGGGAACAGCTGGAAGG + Intergenic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1071600019 10:86954471-86954493 AGGGAGAGGGAGCCTGTGGGAGG + Intronic
1071602417 10:86964807-86964829 AGGGAGAGGGCACCTATGCCCGG + Intronic
1071755723 10:88536670-88536692 AGACAGAGGGAACAAGTGCCAGG - Intronic
1072624843 10:97104667-97104689 AGGGAGAGGGAGGCTGTAGCTGG - Intronic
1073010308 10:100354040-100354062 AGGCATGGGGAACATGAGGCAGG - Intronic
1073073140 10:100807431-100807453 TGGGTGAGGGAACAGGTGGGCGG - Intronic
1073103765 10:101020725-101020747 AGGGAGAGTGAGAATGGGGCGGG + Intronic
1073141800 10:101253276-101253298 GGGGTGGGGGAACATTTGGCAGG + Intergenic
1073186213 10:101616611-101616633 AGGGAGATGGCCCAGGTGGCAGG + Intronic
1073208277 10:101780067-101780089 AGGGAGAGGGAAGTCGGGGCTGG - Intronic
1073353310 10:102835019-102835041 AGGGAGAGGGGGCATGAGGGTGG + Intronic
1075702827 10:124480148-124480170 AGGAAGAGGCAACCTGGGGCTGG + Intronic
1076175384 10:128364081-128364103 AGGGAGAAGGAACACTTGGAAGG + Intergenic
1076530180 10:131139451-131139473 AGGGAGAGGGAACTGGGTGCGGG + Intronic
1076859313 10:133133113-133133135 AGGGTCAGGGAGCAAGTGGCAGG - Intergenic
1077020015 11:413209-413231 ATGGAGAGGGAATAGGTGGCAGG - Intronic
1077168799 11:1157349-1157371 AGAGAGAGAGCACATGCGGCAGG - Intergenic
1078456216 11:11477502-11477524 AGGGAGAGGAAAGGTGTGGAGGG - Intronic
1078551902 11:12287050-12287072 AGGGACAGGGAAGATGGGGTGGG - Exonic
1079311086 11:19366486-19366508 TGGGTGAGGAAGCATGTGGCTGG + Intronic
1079919560 11:26415739-26415761 AGGAAAAGAGAACATGTGCCTGG - Intronic
1080562182 11:33474046-33474068 AGAGAGAGGGAGAAGGTGGCAGG + Intergenic
1081092377 11:38888350-38888372 ATGGAGAGGCAAGAAGTGGCGGG - Intergenic
1081567060 11:44266497-44266519 GGGGAGAGGGAACAGAGGGCTGG + Intronic
1083046985 11:59745647-59745669 AGAGAGAGAGAAAATTTGGCAGG - Intronic
1083707219 11:64524877-64524899 ATGGAGGGGGCACATGGGGCAGG - Intergenic
1084565199 11:69924613-69924635 AAGCAGAGGGAGCATGTGACAGG - Intergenic
1084709410 11:70834867-70834889 AGGGAGAGAGACCCTGTGGGAGG - Intronic
1084748585 11:71189119-71189141 AGGGAGAGGGAATGAGTGGTCGG - Intronic
1085349073 11:75786712-75786734 AGGCAGAGGGAAGGAGTGGCTGG - Intronic
1085508674 11:77074383-77074405 AGGGAGAGGGAAAAGGTGGGAGG - Intronic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086453358 11:86938551-86938573 AGGAAGAGGAATGATGTGGCTGG + Intronic
1087026363 11:93653704-93653726 AGGGAGATGGAACATGCTGGAGG + Intergenic
1087161098 11:94948863-94948885 AGTGAGAGGCAAGATGAGGCAGG - Intergenic
1087213092 11:95463005-95463027 AGAGAGAGAGAACAGGTGGAGGG + Intergenic
1088815961 11:113421109-113421131 AGGGAGAGGGAGTAGCTGGCTGG - Intronic
1089177842 11:116561207-116561229 AGGTAGAGGGAGGATGGGGCAGG - Intergenic
1089537712 11:119170837-119170859 GGGGAGAGGCAAGACGTGGCAGG + Intronic
1089554028 11:119305005-119305027 AGGGAGAGCAGAGATGTGGCAGG + Exonic
1089603647 11:119629286-119629308 AGGCAGAAGGGACAGGTGGCAGG + Intronic
1090198680 11:124839092-124839114 AGGGAGAAGGAATAGGGGGCAGG - Intergenic
1090534740 11:127628381-127628403 TGGGCGAGGGAACACCTGGCTGG - Intergenic
1090670326 11:128941270-128941292 AGGGAGAGGAAACACGTCGCAGG - Intronic
1091209524 11:133844447-133844469 AGGGAGAGGGGAGAGGTGGGAGG - Intronic
1091712779 12:2753387-2753409 AGCGAGAGGGAGCCTGTGTCGGG + Intergenic
1092052945 12:5485869-5485891 AGGCAGAAGAAACATGTGTCTGG - Intronic
1092471318 12:8784494-8784516 AGGGAGAGGGATCAGTAGGCAGG + Intergenic
1093779869 12:23122687-23122709 AGGCAGAGGGAACAGCAGGCAGG + Intergenic
1095308680 12:40668789-40668811 AGGCAGAAGTAACATGTGGAAGG + Intergenic
1095412194 12:41936485-41936507 AGGGAGGGGCAACATCTGGGAGG - Intergenic
1095849960 12:46791753-46791775 AGGGAGAGGGTACATGAAGGAGG + Intronic
1096229710 12:49890096-49890118 AGGTAAAGGGAACAGGTGGAAGG - Exonic
1096573696 12:52539842-52539864 AGGGAGAGAGGAGATGGGGCTGG - Intergenic
1096694331 12:53339058-53339080 AGGGAGAGGCGCCATGTGGCAGG + Intronic
1097594745 12:61615242-61615264 AGGGATAGATAACATGTGGGTGG - Intergenic
1097633053 12:62087632-62087654 AGGGATAGGTAAGATGTGGTAGG + Intronic
1098009381 12:66034154-66034176 AGGGAGAGGGAAGAGGAGGAAGG + Intergenic
1098961681 12:76745644-76745666 AGGAAGAGGGAAGAGGTGCCAGG - Intergenic
1099168452 12:79336228-79336250 CTGGAGAGGGACTATGTGGCAGG - Intronic
1099335583 12:81352474-81352496 AGGGAAAGGGAAAGTGAGGCAGG - Intronic
1099903833 12:88747820-88747842 AGGGTTAGGGAATATGTGGTAGG - Intergenic
1100079637 12:90832546-90832568 AGGGAGAGACAAAAGGTGGCAGG + Intergenic
1100251418 12:92828777-92828799 AGTGAGAGCGAACTAGTGGCAGG - Intronic
1101711442 12:107270747-107270769 TGGGAGATGGCACATGTGCCTGG - Intergenic
1102628464 12:114255462-114255484 CAGGAGAGGGAATATGTGGGAGG + Intergenic
1103825101 12:123731794-123731816 GAGGAGAGGGAGGATGTGGCTGG - Intronic
1103883812 12:124186284-124186306 GGGGAGGGGGAACATGGTGCAGG + Intronic
1104219987 12:126773355-126773377 GGGGAGAGGGGAGATGTGGCAGG + Intergenic
1104390325 12:128386426-128386448 ACGGAAAGGGAAAATGTGGAGGG - Intronic
1104501645 12:129291969-129291991 TGGGAGATCGAACATGGGGCAGG + Intronic
1104647569 12:130508279-130508301 AGGGAGAGGCAAGATCTGGCAGG - Intronic
1104750406 12:131234823-131234845 AAGGAGAGGGAACAAATGCCAGG - Intergenic
1104782314 12:131429639-131429661 AAGGAGAGGGAACAAATGCCAGG + Intergenic
1104783777 12:131437147-131437169 AAGGAGAGGAAACAGGTGGAGGG - Intergenic
1105038535 12:132943836-132943858 AGGGCGAGGGAAAATGAGGCTGG + Intronic
1105326730 13:19377086-19377108 TGGAAGAGGGAACAGCTGGCAGG + Intergenic
1105434846 13:20367584-20367606 AGGGAGAGGGAGCCAGTGCCAGG + Intergenic
1105728432 13:23187664-23187686 AGGCAGAGGGAACATGTGCGAGG - Intronic
1106279877 13:28257251-28257273 AGGGAGAAGGAACAGGAGTCAGG + Intronic
1107061756 13:36166848-36166870 AGGCAGAGGGCACAAGTTGCCGG - Intergenic
1107717618 13:43216373-43216395 AAGGAGAGAGAACTTGTGCCAGG - Intronic
1107850210 13:44563634-44563656 AGGGTGAAGGAAAATGTGTCAGG - Intronic
1109255233 13:60072085-60072107 TGGGAGAGGGCCCATGTGGAAGG - Intronic
1109744539 13:66606160-66606182 AGGCAGAGGGAACAAATGGCTGG + Intronic
1110271337 13:73594237-73594259 AGAGAGAGAGAGAATGTGGCTGG - Intergenic
1110807604 13:79775059-79775081 TTATAGAGGGAACATGTGGCTGG + Intergenic
1112199264 13:97259442-97259464 AGGGAGGGTGAAAAGGTGGCAGG - Intronic
1112375046 13:98831488-98831510 AGGGAGAGCGGACATGTGTGCGG - Exonic
1112639478 13:101256574-101256596 GGGGAGAGGGAAGAGGTGCCTGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1113265016 13:108607362-108607384 TGGGGGAGGGACCATGTGGGAGG + Intronic
1113529048 13:111006618-111006640 TGGGAGTAGGAACAGGTGGCTGG + Intergenic
1113808989 13:113126247-113126269 AGGAAGAGGGTACAGGTGGCAGG - Intronic
1113809983 13:113134565-113134587 AGTGAGAGGGACCAAGTGGGAGG - Intronic
1114424714 14:22612044-22612066 AAGGACAGGGAACTTGTGGCTGG - Exonic
1114647800 14:24265184-24265206 GGGCAGGGGGAACATGTGGAAGG + Intergenic
1115964933 14:38877402-38877424 AGGGAGAGGGAGCATGAGAAAGG - Intergenic
1116350229 14:43852202-43852224 AGGGAAAGGAAAAATGTGCCAGG - Intergenic
1117287025 14:54295816-54295838 AGGGAAAGGGAGCATGGTGCAGG - Intergenic
1117464869 14:55982884-55982906 AGGGAGTGGGAACATGAGATAGG - Intergenic
1117646711 14:57860822-57860844 AGGGACAGGGAACAGATGGTAGG - Intronic
1118973428 14:70656562-70656584 AGGAACAGGGAACATGTCTCTGG + Intronic
1119670454 14:76514328-76514350 AGGAAGAGGGAACAGGCGGAGGG + Intergenic
1119778029 14:77260271-77260293 GGGGAGAGGGGACAAGTGGACGG - Intergenic
1119881918 14:78106418-78106440 AGGGAGAGGGAAGATGTGGTTGG + Intergenic
1120361109 14:83503371-83503393 TGGAAGATGGAAAATGTGGCTGG - Intergenic
1120411261 14:84159068-84159090 AGGGAGAGGGGAAGTATGGCAGG + Intergenic
1120473706 14:84959840-84959862 GGGGAGAGGGTGCATGTGGGTGG + Intergenic
1120565533 14:86050999-86051021 AGGGAGAGGGAAGAGGAGGCGGG - Intergenic
1120590793 14:86371221-86371243 AGGGAGAGGAAAGATGATGCAGG - Intergenic
1120929562 14:89835112-89835134 AGTGACAGGGAAAATGGGGCAGG + Intronic
1121063571 14:90939623-90939645 AGAGAGAGAGAACTTGTTGCAGG + Intronic
1121489746 14:94349321-94349343 ATGCAGAGGGAACTTGTTGCGGG - Intergenic
1122268618 14:100558329-100558351 AGGGAGAGGCAGCATGTGCCTGG - Intronic
1123106181 14:105842306-105842328 AGGGAGCGGGCACTGGTGGCTGG - Intergenic
1123813659 15:23954988-23955010 AGGGACAGGGGACAGGGGGCAGG + Intergenic
1123880795 15:24676223-24676245 CAGGAGAGTGAACATGCGGCTGG - Exonic
1124708873 15:31988461-31988483 AGTGAGAGGGAACATCCAGCGGG - Intergenic
1125330285 15:38575312-38575334 AGGGAGAGGGAAAAGGAGGGAGG + Intergenic
1126006324 15:44261300-44261322 AGAGGGAGAGAAAATGTGGCGGG + Intergenic
1126550747 15:49926518-49926540 AGGGAGAGGGAAGCTATTGCAGG - Intronic
1126930046 15:53637754-53637776 AGGGAGAGAGAATATGGGGCTGG - Intronic
1127691117 15:61398660-61398682 AGGGAGAGGGGAAAGGTGGAGGG + Intergenic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1128751824 15:70155547-70155569 AGGCCCAGGGAACAGGTGGCCGG + Intergenic
1129326248 15:74801661-74801683 AGTCTGAGGGGACATGTGGCTGG + Intronic
1130043348 15:80424516-80424538 AGAGAGAGGCAACATCTGACTGG - Intronic
1130162634 15:81416402-81416424 AGGGAGAGGAGAAATGTGGTAGG - Intergenic
1130334794 15:82949567-82949589 ATGGAGAGTGAACAAATGGCAGG + Intronic
1130752138 15:86723812-86723834 AGGGGGAGTGAAAAGGTGGCAGG + Intronic
1130937117 15:88480000-88480022 AGGGAGAGGGAAGAAATGCCTGG + Exonic
1132664646 16:1075998-1076020 AGGGAGAGAGAAAAGGTGGGGGG - Intergenic
1132664741 16:1076247-1076269 AGGGAGAGGGAGGGGGTGGCAGG - Intergenic
1132669400 16:1096496-1096518 AGGCAGATGGAAGCTGTGGCTGG + Intergenic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1132833604 16:1941806-1941828 AAGGAGAGGGACCAGGTGGTTGG - Intronic
1133172177 16:3988274-3988296 CGGGAGAGGGAACATGGAGCCGG + Intronic
1134001641 16:10787474-10787496 AGGGGCAGGCAACATGGGGCAGG + Intronic
1134122780 16:11596649-11596671 GGGGAGAGGGAGGATGTGGAGGG + Intronic
1134236161 16:12468096-12468118 GGGCAGAGGGAACATGTGGCAGG - Intronic
1135328232 16:21541488-21541510 TGGGAGCGGGGACGTGTGGCCGG - Intergenic
1135704483 16:24663124-24663146 AGGGAGTGGGAAGATGTGTCGGG + Intergenic
1135845419 16:25914111-25914133 AGGGAGAGGGTATATGTGTGTGG + Intronic
1136136426 16:28259240-28259262 AGTGAGAAGGCACAGGTGGCGGG + Intergenic
1136338581 16:29627461-29627483 TGGGAGCGGGGACGTGTGGCCGG - Intergenic
1136398297 16:30004835-30004857 AGGGAGAGGAAGCTGGTGGCAGG + Intronic
1137330679 16:47492525-47492547 AGGGAGTGGGACCTTCTGGCTGG + Intronic
1138520300 16:57567283-57567305 AGGGAGATGGGAGATGTGGAGGG + Intronic
1139306834 16:65993759-65993781 AGGGAGAGGCAGCATGAGCCTGG - Intergenic
1139307641 16:66000983-66001005 AGAGGAAGGGCACATGTGGCTGG - Intergenic
1139380858 16:66529787-66529809 AGGGAGAGGGAGGAAGTGCCTGG - Intronic
1139576961 16:67847624-67847646 AGGGTCAGGGAATATGAGGCGGG + Intronic
1139839712 16:69868430-69868452 AGGGACAGGGAACCCGGGGCTGG + Intronic
1140096386 16:71879299-71879321 AGGGAGAGGGAACATCAGGTAGG - Intronic
1141784455 16:86189358-86189380 TGGAAGAGGGAACATGGGGTGGG - Intergenic
1141894040 16:86947175-86947197 AGGAGGAGGGAACATGGGGCTGG - Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142127534 16:88417590-88417612 AGGAAGAGGGACCATGTGCGGGG - Intergenic
1143587181 17:7856154-7856176 AGGAACAGGAAACATGTGCCAGG + Intergenic
1144390841 17:14792019-14792041 AGGAACATGGAGCATGTGGCAGG - Intergenic
1144626780 17:16847959-16847981 AGGCACAGGGAACATCAGGCAGG + Intergenic
1144879654 17:18424751-18424773 AGGCACAGGGAACATCAGGCAGG - Intergenic
1145152582 17:20519634-20519656 AGGCACAGGGAACATCAGGCAGG + Intergenic
1145815150 17:27789842-27789864 AGGAAGAGGGAAGATGGGGATGG - Intronic
1146047654 17:29523326-29523348 AGGGAGATGGACCAGGTGGCTGG - Intronic
1147253472 17:39167192-39167214 AGGGAGAAGCCCCATGTGGCTGG - Intronic
1147447906 17:40486066-40486088 AGGGAGGGGGAACAGGGGGTTGG + Intronic
1147457966 17:40550388-40550410 AGGCAGGGGGAAGATGGGGCAGG - Intergenic
1147580923 17:41626652-41626674 AGGCACAGGGAACATCAGGCAGG + Intergenic
1148642923 17:49201670-49201692 AGGGAGGGGGAACAGCTGACTGG - Intergenic
1148688986 17:49515850-49515872 AGGAAGATGGAAGATGTTGCGGG + Intergenic
1148694034 17:49548495-49548517 AGGAAGGGGGAGCATGAGGCTGG - Intergenic
1148807144 17:50269629-50269651 AGGGAGAGGACACCTGTGACAGG + Intergenic
1148836376 17:50467931-50467953 AGGGACAGGGAACCTGGGGACGG + Intronic
1149524990 17:57348557-57348579 AAGGAGAGGGAAGAGGTGCCAGG - Intronic
1150207841 17:63422164-63422186 AGAGGGAGAGAGCATGTGGCTGG - Exonic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1150638756 17:66934953-66934975 AGAGAGAGGGAGCATGTGCAGGG + Intergenic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1151249236 17:72820816-72820838 AGGGAGGAGAAACATGTGGATGG + Intronic
1151816879 17:76475509-76475531 AGGGAGAGTGAACAGCTGGTGGG - Intronic
1152134019 17:78493681-78493703 AGGGAGTGGTGACATGTGGAGGG - Intronic
1152336242 17:79701381-79701403 AGGGGGAGGGCACAGGTGGGAGG + Intergenic
1152336354 17:79701673-79701695 AGGGGGAGGGCACAGGTGGGAGG + Intergenic
1152728251 17:81958140-81958162 AGGCAGTGGGAGCATGGGGCAGG + Intronic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1158416941 18:57256965-57256987 AGGGAAAGGGAGCAGGAGGCTGG + Intergenic
1160761739 19:788942-788964 AGGGAGAGGGAACGTGAGCCGGG - Intergenic
1160900178 19:1424079-1424101 AGGAAGAGGGAGGAGGTGGCGGG - Intronic
1162022278 19:7873372-7873394 AGGGGGAGGGAAGATGGGGGCGG + Intronic
1162297440 19:9823003-9823025 ACGAAGAGGGAAAATGAGGCCGG + Intronic
1162363591 19:10234164-10234186 AGGGAGAGGAACCAGGGGGCAGG + Intergenic
1163491302 19:17618512-17618534 GGGGAGAGGGGCCATGTGGGTGG + Intronic
1163793001 19:19319264-19319286 AGGGAGGGGAACCATCTGGCGGG - Intronic
1164411118 19:28006263-28006285 AGGGAGAGAGAAGAGATGGCCGG - Intergenic
1164544337 19:29146916-29146938 ATGAACAGGGAACCTGTGGCAGG - Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164597296 19:29538737-29538759 AGAGAGAGGGAGGATGTGCCAGG + Intronic
1164730764 19:30502497-30502519 AGAGAGAGGGCAGCTGTGGCTGG + Intronic
1165013899 19:32867019-32867041 AGGGAAAGGGAGCTTGGGGCTGG - Intronic
1165327588 19:35123218-35123240 AGGGAGAGGGCAAATGGGGGCGG + Intronic
1165550614 19:36581678-36581700 AGGGAGAGGGAGGAGGTGCCAGG - Intronic
1166727874 19:45039606-45039628 AGGGAGTGGGAACACGGGGAGGG - Intronic
1166982034 19:46636548-46636570 AGGGACAGTGAGCATGAGGCTGG - Intergenic
1167748509 19:51366797-51366819 AGGGACAGGGAACACGGGGATGG - Intronic
1167749875 19:51373015-51373037 AGGGGGAGGGCAGATGTGGCTGG + Intergenic
1167763090 19:51461728-51461750 AGGGAGAGGAACCATGGGGCTGG - Intergenic
1168171638 19:54593822-54593844 AGGGAGGGTGACCATGTGGGAGG + Intronic
1168176354 19:54630674-54630696 AGGGAGGGTGACCATGTGGGAGG + Intronic
1168300626 19:55402787-55402809 AGGGAGGCGGTACATGTGGGAGG + Intronic
1202714777 1_KI270714v1_random:36173-36195 AGGGAGAGGGCACACGTGACAGG - Intergenic
925090148 2:1148695-1148717 AATGAGAGTGAACATGTGGAGGG + Intronic
925254148 2:2467937-2467959 CGGGAGAGGGACCGTGTTGCGGG - Intergenic
925264606 2:2558191-2558213 ATGGAGAGAGGAAATGTGGCTGG + Intergenic
925274065 2:2636621-2636643 AGGGTGAGAGACCAGGTGGCTGG - Intergenic
925871446 2:8274986-8275008 AGGGAGAGAGATGAGGTGGCCGG + Intergenic
925894868 2:8463355-8463377 AAGGAGAGAGAACCTGTGCCAGG + Intergenic
926223780 2:10953335-10953357 AGGGACAGGGCAGATGTGACAGG + Intergenic
926830075 2:16952038-16952060 ATGAAGAGGGAACCTGTGACAGG - Intergenic
926886955 2:17606717-17606739 AGGGATAGGGACCATCTGGTAGG - Intronic
926921555 2:17945615-17945637 AGGGAGTGGGTACAAGTGACAGG - Intronic
927168248 2:20346764-20346786 AGGGAAATGGAACCTGTAGCTGG - Intronic
927246439 2:20960396-20960418 AGGGAGTGGGATCCTGAGGCTGG - Intergenic
927430587 2:23023409-23023431 AGGGGGAGGCAAGGTGTGGCTGG - Intergenic
927488361 2:23504557-23504579 AGGGAGGGGGCACAGGGGGCAGG + Intronic
927510896 2:23643025-23643047 AGGGAGGGGGAAGGTGTGGAGGG + Intronic
927721738 2:25387550-25387572 AGGGAGAGGGACCAGTGGGCTGG - Intronic
927862851 2:26570925-26570947 AGGGAGAGGTCAGATGTGGAGGG + Intronic
927920786 2:26970751-26970773 AGGGGGAGGGGACAGGTGGCGGG - Exonic
928310399 2:30204923-30204945 AGGGAAAAGCAACATGTGCCTGG - Intergenic
928920785 2:36525012-36525034 AGGGGGAGGGAAGTTGTGGAGGG - Intronic
929782257 2:44964786-44964808 AGGGAGAGGGAACACTGGGCGGG - Intergenic
930073862 2:47391036-47391058 AGGGAGGGGGAACATGTCTTAGG - Intergenic
930384371 2:50675031-50675053 AGCGAGAGGGAAGAGGTGTCGGG - Intronic
931183878 2:59930877-59930899 AGGGAGAGGGACCAGGAAGCAGG + Intergenic
931820189 2:65943739-65943761 GGGGAGAGGGGACATGAGGCTGG + Intergenic
932211790 2:69937535-69937557 AGGGAGAAGGAACCTGTCACTGG - Intronic
932700676 2:73989212-73989234 TGGCAGAGGGAACATGTCCCGGG + Intronic
932779643 2:74552246-74552268 AGGGAAAGGGAACACGAGGATGG - Intronic
933773092 2:85755865-85755887 AGGGTTAGGGTAGATGTGGCTGG + Intronic
934781227 2:96970969-96970991 GTGGGGAGGGAACAGGTGGCTGG - Intronic
935310785 2:101781338-101781360 AGGGGGAGGGAAGATCTGGCTGG - Intronic
935745995 2:106190780-106190802 GGGGAGAGGGAAATGGTGGCAGG + Intronic
935783544 2:106529260-106529282 AGGGAAAGGGAATCTGGGGCTGG + Intergenic
936152999 2:110031880-110031902 AGGGAGAGGGAGGGTGGGGCTGG + Intergenic
936191681 2:110339532-110339554 AGGGAGAGGGAGGGTGGGGCTGG - Intergenic
936624487 2:114133680-114133702 AATGAGAGGGAACATGTTCCTGG - Intergenic
936921714 2:117695963-117695985 AGCAAAAGTGAACATGTGGCAGG + Intergenic
937007597 2:118531478-118531500 AGAGAGGGGGAAGAGGTGGCTGG - Intergenic
937039223 2:118808011-118808033 AGGGAGAGGGGGGAGGTGGCAGG + Intergenic
937797884 2:126046861-126046883 TGGGAGAGGGACCTTGTGGGAGG + Intergenic
937912100 2:127080768-127080790 AGGGAGGGGGGGCAGGTGGCAGG + Intronic
938739666 2:134219223-134219245 AAGAAGAGAGCACATGTGGCAGG + Intronic
938749367 2:134314180-134314202 AGGTAGAGGGAATCTGTGACTGG - Intronic
940019922 2:149145942-149145964 GGGCAGAGGAAACATGTGACCGG + Intronic
940101803 2:150048640-150048662 AGGGAGATGGGAGATGTGGAAGG + Intergenic
940373030 2:152923223-152923245 AGGGAGAGAGAAAGTGAGGCAGG - Intergenic
941438474 2:165502726-165502748 AGAGAGAGGGAGCCGGTGGCAGG - Intronic
941970207 2:171341932-171341954 AGGGAGAGGAAAGGAGTGGCTGG + Intronic
942978129 2:182044014-182044036 AGGGTGGGGGAACAGGTGACAGG - Intronic
944190004 2:196992602-196992624 AGGGTGAGGGAAGGTGAGGCGGG + Intronic
944812473 2:203341155-203341177 AGGGAGAGTGAGCAAGGGGCAGG - Intronic
945158764 2:206866777-206866799 AGGGACCGGGAACATCTGGCAGG - Intergenic
945869854 2:215215293-215215315 AGGGAGAGGGAAAATCAGGGTGG + Intergenic
946427367 2:219606437-219606459 AGGGGGAGGGAGTATGTGGTAGG - Intronic
948356671 2:237383781-237383803 AGGGGGAGGGAAAACGTGGGAGG - Intronic
948747961 2:240109589-240109611 AGGGAGCTGGAACATGAGGCCGG - Intergenic
1168867138 20:1096622-1096644 AAGGGGAGGGAACATGAGGAGGG - Intergenic
1170187239 20:13604362-13604384 AAAGAGAGGGAAGAGGTGGCAGG - Intronic
1170550709 20:17473856-17473878 TGAGAGAGGAGACATGTGGCTGG - Intronic
1170728297 20:18948884-18948906 AAGGAGAGGGAACAAGGGGCTGG + Intergenic
1170900576 20:20458631-20458653 AAGGAGAGGGAGCAAGGGGCTGG + Intronic
1171292467 20:23990167-23990189 TGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1171962175 20:31502846-31502868 AGGGAGAGAGAACACCAGGCAGG + Intergenic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1173784088 20:45779956-45779978 AGAGAAAGGGATCACGTGGCAGG - Intronic
1173927827 20:46793885-46793907 TGGGACAGGGAAAATGTGGAAGG - Intergenic
1174983900 20:55428040-55428062 GGGGAGTGGCAACATGAGGCTGG + Intergenic
1175337611 20:58206387-58206409 AGGAACAGGGAAAATCTGGCAGG - Intergenic
1175588467 20:60166823-60166845 AGGGAGAATGAACATTGGGCAGG + Intergenic
1175739925 20:61413200-61413222 AGGGAAAGGGAGCATGGGCCAGG - Intronic
1176065768 20:63193771-63193793 AGGAATAGGGCTCATGTGGCTGG + Intergenic
1176257253 20:64158843-64158865 GGGGAGGGGGGACATGTGGGGGG - Intronic
1177443289 21:21157090-21157112 GGGGATAAGGAACACGTGGCAGG - Intronic
1178077489 21:29025041-29025063 GAGGAGAGGGAAGGTGTGGCAGG + Intronic
1179434619 21:41351672-41351694 AGTGGGAGTGAACATGGGGCTGG - Intronic
1179468258 21:41592798-41592820 AGGGAGATGGAAGATATGGTCGG - Intergenic
1179876886 21:44273145-44273167 GGGCAGAGGGAAGATGTGGAGGG + Intergenic
1179901965 21:44399104-44399126 AGGGAGAGGGCACGTAGGGCTGG - Intronic
1179930757 21:44569456-44569478 ACAGAGTGGGAAGATGTGGCAGG + Intronic
1180595063 22:16967685-16967707 AGGCAGAGGGCAGATGAGGCAGG - Intronic
1181123962 22:20691027-20691049 TGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1182129609 22:27841287-27841309 AGGGAGTGGGAACCAGTGTCTGG - Intergenic
1182675188 22:32033803-32033825 AATGAGAGGGAACCTGTGGTGGG + Intergenic
1183831760 22:40421947-40421969 AGACAAAGTGAACATGTGGCAGG + Intronic
1184116424 22:42425445-42425467 AGGGCGAGGGATCTTGTGGGAGG - Intronic
1184138074 22:42561227-42561249 AGGGTGAGGGAACAGCTGGAGGG + Intronic
1184275450 22:43407193-43407215 AAAAAGTGGGAACATGTGGCTGG - Intergenic
1184361591 22:44022396-44022418 AGGGACAGGGACCATGTGGATGG - Intronic
1184450147 22:44577823-44577845 TGGCAGAGGGAACTAGTGGCTGG + Intergenic
1184482811 22:44758029-44758051 AGGGAGTCGGAACAGGTGGGAGG + Intronic
1184982663 22:48105356-48105378 GGGGAGAGGAAAGATGGGGCAGG + Intergenic
1185014480 22:48335093-48335115 TGGGAGACCGAACATGTGGTTGG + Intergenic
1203273676 22_KI270734v1_random:73834-73856 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
949318740 3:2785852-2785874 TGGGAAAGGCAACATGTGGGTGG - Intronic
949919807 3:8991742-8991764 AGGGAGAGGGACCGTGTGTTGGG + Intronic
950262751 3:11554340-11554362 AGTTAGAGGGAACATGGAGCAGG + Intronic
950505190 3:13390213-13390235 AGGGTGACGGGACATGAGGCTGG + Intronic
950851162 3:16063581-16063603 TGGTAAAGGGAACATGAGGCTGG - Intergenic
951488511 3:23241861-23241883 AATGATAGGGAAGATGTGGCAGG - Intronic
951597285 3:24332058-24332080 AGGAAGTGGGAAAATGTGGCTGG - Intronic
952298633 3:32084563-32084585 AGGGAGAGGGAATGTGTGCATGG + Intergenic
952879453 3:37974417-37974439 AGGCAGAGAGCACCTGTGGCTGG - Intronic
953434597 3:42868461-42868483 AGGGTGAGGGAATACCTGGCTGG - Intronic
953879288 3:46683331-46683353 TGGGAGGGGGAACATGGGGAAGG + Intronic
953906069 3:46868808-46868830 AGGGAGATTGAAAATGTGTCTGG + Intronic
954123915 3:48517539-48517561 AGTGAGAGTGAACATGGGGGTGG + Intergenic
954384417 3:50236803-50236825 AGGGTTGGGGAACAAGTGGCGGG - Intronic
954413693 3:50382498-50382520 AGGGAGTGGGAGCAGGGGGCAGG - Intronic
954876412 3:53805758-53805780 AGGAAGAGGGAAGATGAGGGAGG - Intronic
954876482 3:53806012-53806034 AGGAGGAGGGAACATGAGGGAGG - Intronic
954876489 3:53806035-53806057 AGGAGGAGGGAACATGAGGGAGG - Intronic
954938499 3:54349093-54349115 AGGGAGAGAGAAAATGGGTCTGG + Intronic
956176679 3:66479388-66479410 AGGGAAAAAGAAAATGTGGCAGG - Intronic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
957002357 3:74900563-74900585 ATGGAGAGGGAACATTGCGCAGG - Intergenic
957260497 3:77896369-77896391 TGTGAGAGGGAGCATGTGGGAGG - Intergenic
959944818 3:112115327-112115349 AGAGAAAGGGAAAATGTGTCAGG + Intronic
961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG + Intergenic
961514524 3:127424426-127424448 AGGGAGAGGGAATCAGTGGCCGG - Intergenic
961561221 3:127731716-127731738 AGGGAGAGGGAACTGTGGGCCGG - Intronic
961782469 3:129328606-129328628 AGGGTGATGGGACATGAGGCTGG + Intergenic
963686673 3:148444081-148444103 AGGGAAAGGGAACAGTTGGAAGG + Intergenic
965166708 3:165203335-165203357 AGCAAGATGGAAAATGTGGCTGG - Intergenic
966730812 3:183150025-183150047 ATGAATAAGGAACATGTGGCTGG + Intronic
967315624 3:188149855-188149877 AGGGAGAGGTAAGATGTGCTTGG + Intergenic
967888199 3:194347213-194347235 AGGGATAGGGAAGGTTTGGCTGG + Intronic
968119748 3:196117464-196117486 AGGGTGAGGGATCATGAGGCAGG - Intergenic
968406265 4:341914-341936 AGGGATAGAGAACAGGTTGCTGG - Intronic
968551108 4:1223716-1223738 AGGGAGGGGGAGCATCTGGGCGG - Intronic
969509596 4:7610255-7610277 GTGGAGAGGACACATGTGGCAGG - Intronic
969651712 4:8471846-8471868 AGGGAGGGGGGAGATGTAGCAGG + Intronic
969798736 4:9545894-9545916 AGGGAGAGGGAAAATCTTTCAGG - Intergenic
970232058 4:13921044-13921066 AGGGCGAGTGAGGATGTGGCTGG - Intergenic
970436429 4:16040022-16040044 AGAGAGAGTGTACAGGTGGCGGG - Intronic
971483327 4:27133892-27133914 AGGGAGAGGGAACATGGGGGTGG + Intergenic
972740888 4:41885050-41885072 AGGAAGATGGAACATGGGGAGGG - Intergenic
973010850 4:45070565-45070587 AGGGAGAGGGACCTGGTGGGAGG + Intergenic
973914250 4:55617460-55617482 AGGAAGAGGGACCAGGTGGGTGG - Intronic
975600143 4:76090515-76090537 AGAGATAGGGAACTTGTGGGAGG + Intronic
975654674 4:76629625-76629647 AGGGAGATGGGAGATGTGGTTGG + Intronic
978404891 4:108368729-108368751 AGGGAGGGGGCACATGAGGTGGG + Intergenic
981073911 4:140572246-140572268 AGGGAGAGAGGACCTGTGACAGG + Intergenic
981367251 4:143917641-143917663 AGCAAGAGGGAGCAAGTGGCTGG - Intergenic
981677849 4:147360244-147360266 AGGGAGATGGAACAGAAGGCAGG + Intergenic
982554060 4:156838796-156838818 TGTGAGAGGGAACAGGTGGAAGG + Intronic
983422896 4:167542929-167542951 AGAGAGAGGAAACATTTTGCTGG + Intergenic
985222752 4:187725642-187725664 AGAGAGAGGGAAAACGAGGCTGG - Intergenic
985756620 5:1723344-1723366 AGGGAGAGGGAAGGCGAGGCTGG - Intergenic
985992862 5:3577883-3577905 AGGGAGAGGGGCCATGGGCCTGG - Intergenic
986844260 5:11734357-11734379 AGTGAGAGGGACCAGGTGGGAGG + Intronic
986844373 5:11735595-11735617 AGTGAGAGGGACCAGGTGGGAGG + Intronic
986920775 5:12676678-12676700 TGGGAGAGGGAACTGGTGGGAGG - Intergenic
987004228 5:13692825-13692847 AGAGAAAGGGAGCATGTGGGTGG - Intronic
987029516 5:13963035-13963057 AGGGAGAGGGAGAAGGTGGCTGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987370799 5:17191245-17191267 AGTGAGAGGGAACATGCGGGCGG - Intronic
987708331 5:21482309-21482331 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
987708507 5:21483116-21483138 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
988407990 5:30849321-30849343 AGAGAAAAGGAACATGCGGCGGG + Intergenic
988751104 5:34191029-34191051 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
988751282 5:34191839-34191861 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
988751450 5:34192646-34192668 TGGGAGTGGGAAGAGGTGGCAGG - Intergenic
990644818 5:57832230-57832252 AGGGAGAGTGAGCACATGGCTGG + Intergenic
991736418 5:69633760-69633782 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991736593 5:69634573-69634595 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991758298 5:69899754-69899776 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
991758472 5:69900570-69900592 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
991812916 5:70489399-70489421 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991815874 5:70509876-70509898 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991816047 5:70510689-70510711 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991816222 5:70511499-70511521 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991837701 5:70775636-70775658 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
993888074 5:93440137-93440159 AGGGAGAGAGAGAATGTGGGTGG - Intergenic
993998424 5:94750101-94750123 AGGGAAAGGGAACAAGGGACTGG - Intronic
994420231 5:99522504-99522526 CGGGAGTGGGAATATGTGGCAGG + Intergenic
994420401 5:99523323-99523345 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
994420567 5:99524142-99524164 CGGGAGTGGGAAGATGTGGCAGG + Intergenic
994486472 5:100390172-100390194 CGGGAGTGGGAACATGTGGCAGG - Intergenic
994486642 5:100390991-100391013 CGGGAGTGGGAAAAGGTGGCAGG - Intergenic
994486809 5:100391810-100391832 CGGGAGTGGGAAGATGTGGCAGG - Intergenic
994486974 5:100392629-100392651 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
994682011 5:102899857-102899879 AGGGAGCTGGTCCATGTGGCTGG + Intronic
995495645 5:112739296-112739318 AGGGAGTGGGGAGGTGTGGCAGG - Intronic
997955567 5:138275948-138275970 AAGGTGAGGGAACATGAAGCTGG + Intergenic
998013219 5:138711838-138711860 ATGAAGAGGGAACAAGTGTCTGG - Intronic
998506079 5:142674020-142674042 AGGGAGGGAGAACAGGTGGGAGG - Intronic
998549507 5:143063801-143063823 AGCAAGAGGGCACTTGTGGCAGG - Intronic
999195754 5:149780436-149780458 AGGGAGAGGGACCCTGTCTCAGG - Intronic
999324254 5:150633433-150633455 AGTGAGAGGGGTCTTGTGGCTGG + Intronic
999907135 5:156154038-156154060 AGGGGCAGGGAACAAGGGGCAGG - Intronic
1000106825 5:158067816-158067838 AAGCAAAGGGAACACGTGGCAGG + Intergenic
1000329518 5:160196005-160196027 AGGCAGAGGGGACATGGGCCAGG + Intronic
1001506212 5:172283171-172283193 AGGGTGCGGAAAGATGTGGCGGG + Intronic
1001770564 5:174293024-174293046 AGGGAGAGGGGCCCTGTGGCAGG + Intergenic
1002568683 5:180128216-180128238 AGGGAGAGGGAGGCTGGGGCGGG - Intronic
1002918670 6:1549626-1549648 AGGGAGATGGAACAATTGCCGGG + Intergenic
1003277980 6:4668570-4668592 ATGGAGAGGGCACATGAGTCAGG + Intergenic
1004305810 6:14500979-14501001 AGGGAGAGATACCATGTTGCTGG - Intergenic
1005549254 6:26897658-26897680 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1005549431 6:26898475-26898497 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1005549607 6:26899295-26899317 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1005549781 6:26900112-26900134 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1006211165 6:32396212-32396234 ATGGATGGGGACCATGTGGCTGG - Exonic
1006410348 6:33870106-33870128 AGGGAGAGAGAACAGAGGGCAGG + Intergenic
1006501547 6:34462573-34462595 AGGGAGAGGGAGGAGGTGGGTGG - Intergenic
1006579481 6:35068593-35068615 GGGGAGAGGGGGTATGTGGCGGG - Intronic
1007234416 6:40379977-40379999 AGGGAGATGGACCATGGGGAGGG + Intergenic
1009019996 6:57938768-57938790 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1009588322 6:65635393-65635415 AGGGAAAGGCAAGATGGGGCGGG - Intronic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1010376479 6:75176350-75176372 AGGGAGAGGGATGCTGTGGGAGG + Intronic
1013150304 6:107439463-107439485 AGGGAGAGGTGGCATGTAGCAGG - Intronic
1013233432 6:108176349-108176371 AGGGAGAGGGAATCTGAGGGAGG - Intronic
1013467485 6:110430340-110430362 AGGGAGAATGTACATGAGGCTGG + Intronic
1014773398 6:125482214-125482236 TGGGAGAGGCAGCATGTAGCAGG + Intergenic
1015293189 6:131561282-131561304 AGGGAGAGGGAAACTGTACCAGG - Intergenic
1016008083 6:139109596-139109618 TGGGAGAGGGAACCGGTGGAAGG + Intergenic
1017125990 6:151065316-151065338 AGTGAGAGGGAGCCTGGGGCAGG - Intronic
1017809043 6:157970873-157970895 AGGGAGAGAGAGCAAATGGCTGG + Intergenic
1018800406 6:167217829-167217851 AGGGACAGGGAGGGTGTGGCTGG - Intergenic
1018809749 6:167289516-167289538 AGGGACAGGGAGGGTGTGGCTGG + Intronic
1018907788 6:168085378-168085400 AGGGAGGGAGACCTTGTGGCGGG + Intergenic
1018986382 6:168640346-168640368 ATGGAGAGGAAGCATGGGGCAGG + Intronic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019628362 7:2032904-2032926 AGGGAGAGTGTGCATGGGGCAGG + Intronic
1019712757 7:2524963-2524985 AGGCAGCGGCAACAGGTGGCGGG + Intronic
1019930987 7:4222947-4222969 AGGGGGAGGGAGCTGGTGGCAGG + Intronic
1020175759 7:5880949-5880971 AGGTAGAGGGGACGTGAGGCGGG + Exonic
1020845983 7:13284376-13284398 AGGGAGAAGGCTCAGGTGGCTGG - Intergenic
1020902254 7:14019594-14019616 AAGGAGAGGAAACAAGTGGTAGG - Intergenic
1021055326 7:16040553-16040575 AGGGAGAGGGAACATGGGAGTGG - Intergenic
1021312569 7:19111948-19111970 AGTAAGAAGGAGCATGTGGCAGG - Intronic
1022096966 7:27147261-27147283 AGGGAGAGGGGAAAGGAGGCAGG - Intronic
1022818694 7:33937903-33937925 AGGGTGATGGAAAATGAGGCTGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023124298 7:36939797-36939819 AGGCAGAGGGGCCAAGTGGCTGG + Intronic
1023474199 7:40559209-40559231 AAGGAGATGGAGCATCTGGCTGG - Intronic
1024300347 7:47882705-47882727 AGGAGGAGGAAAAATGTGGCTGG + Intronic
1025708341 7:63886931-63886953 TGGGAGAGGGAAGAGGTGGTGGG - Intergenic
1027941416 7:84685758-84685780 ATGGAGAGGGAACAAGGGCCAGG + Intergenic
1028649750 7:93138535-93138557 AGAGAGTGGGAACATTGGGCAGG + Intronic
1028964772 7:96789969-96789991 AGAGAGAAGGCCCATGTGGCTGG - Intergenic
1029083069 7:97990023-97990045 AGGTAGAGGGGACGTGGGGCGGG - Exonic
1029951070 7:104586364-104586386 AGGGAGAAGAAACTTGTGGGTGG - Intronic
1030746849 7:113175981-113176003 AGGGAGAGGAAACCAGTGTCAGG + Intergenic
1031307262 7:120145804-120145826 AGAGAGATGGAAAATGTGGCAGG - Intergenic
1031873927 7:127116688-127116710 AGTGAGAGGCAATCTGTGGCTGG - Intronic
1031913989 7:127545513-127545535 AGAGAGAGGGAACTGGTGGGAGG - Intergenic
1031925329 7:127633176-127633198 AGGAAGAAGGAGCATGTGGGAGG + Intergenic
1032088903 7:128900870-128900892 AGGGAGAGGGAAAATGTCAGAGG + Intronic
1032151908 7:129436032-129436054 AGGGAGGGAGATGATGTGGCGGG - Intronic
1033140871 7:138825281-138825303 AGTGCGAGGGAACAGGTGGTTGG - Intronic
1033537933 7:142329026-142329048 AGGGAGAGACAACATGAGGGTGG - Intergenic
1033591017 7:142808682-142808704 AGGGCCAGGGAACAGGTGTCAGG - Intergenic
1035670760 8:1415453-1415475 AGGGGGAGGGAAAAAGGGGCTGG - Intergenic
1036766804 8:11554596-11554618 AGGGAAAGGAAACTTGTGGAGGG + Intronic
1036889614 8:12587668-12587690 AGGGAGAGGGAAAATTTTTCAGG + Intergenic
1037767773 8:21782519-21782541 AGGCAGAGAGGACGTGTGGCGGG - Intronic
1038079655 8:24119542-24119564 AGGGATACTCAACATGTGGCTGG + Intergenic
1038226522 8:25663241-25663263 AGGAATAGGGAACATGGGGATGG + Intergenic
1038401206 8:27286345-27286367 TGGGAGAGGGAAGAGGAGGCTGG - Exonic
1038809399 8:30824824-30824846 AGGTAGAGGCAACAAGTGACTGG + Intergenic
1040337790 8:46424888-46424910 AGGCAGAGGGGAGAAGTGGCGGG + Intergenic
1043509593 8:80936548-80936570 AGGGAGAGGTTACATTTAGCTGG - Intergenic
1044535963 8:93356796-93356818 AGGAAGAAGGAACATGAAGCTGG - Intergenic
1044559347 8:93597187-93597209 AGGGAGAAGGAAGATGTCGCAGG - Intergenic
1045167980 8:99628456-99628478 AGGAAAAGGGAACAGGAGGCAGG - Intronic
1045311429 8:101006641-101006663 ACGGAGAGGCAAGATGTGGTAGG - Intergenic
1045319683 8:101072621-101072643 AGAGAGAGAGAACAAGAGGCAGG + Intergenic
1045734113 8:105275197-105275219 AGGGAGAGGAAAGTTGGGGCGGG - Intronic
1047694456 8:127389402-127389424 GCGGAAAGGGAACAGGTGGCAGG - Intergenic
1047838905 8:128726014-128726036 AGGGACAGAGAAGACGTGGCTGG + Intergenic
1048337858 8:133516247-133516269 AGGGAGAGGGAACAAGAGAGAGG - Intronic
1048340642 8:133536201-133536223 AGGGAGAGCACACATGAGGCTGG + Intronic
1049378441 8:142300572-142300594 CGGGAGTGACAACATGTGGCAGG - Exonic
1049687422 8:143944509-143944531 TGGGTGAGGGCACATGAGGCAGG + Intronic
1050004881 9:1119539-1119561 AGGCAGAGGGACCATGTGCATGG + Intergenic
1050631886 9:7568406-7568428 AGAGAAAGGGAAAATGTGGTGGG - Intergenic
1051072939 9:13194826-13194848 AGGGATAGGGTTAATGTGGCAGG - Intronic
1051937782 9:22465511-22465533 CAGGAGAGGGAACTGGTGGCGGG + Intergenic
1052334580 9:27306602-27306624 AGGGAGATAGAATATGAGGCTGG - Intergenic
1055397720 9:75891932-75891954 AGGGGGAGGGAAGAGGGGGCCGG + Intronic
1055795046 9:79967026-79967048 AGTAAGAGGGAACAGGTGTCAGG + Intergenic
1056035162 9:82596672-82596694 GTGGAAAGTGAACATGTGGCAGG - Intergenic
1056482056 9:87015915-87015937 AGAGAGAGAGAACAAGTGGGAGG + Intergenic
1057429324 9:94979864-94979886 AGGGACAGGGACCATGGGGCAGG - Intronic
1057767984 9:97940346-97940368 AGATACAGGGAACATGGGGCAGG - Intronic
1059130912 9:111748700-111748722 AGGGATAGGTAAAATGTGTCAGG - Intronic
1059606071 9:115837832-115837854 ATGGAGAGTGAATTTGTGGCAGG - Intergenic
1059710669 9:116865025-116865047 GAGGAGAGGGTAAATGTGGCTGG - Intronic
1059961495 9:119569484-119569506 AGGAAGAGAGAACAGGCGGCTGG - Intergenic
1060899918 9:127248248-127248270 AGGGAGAGAGGAAATGGGGCAGG - Intronic
1060933356 9:127502743-127502765 GGAGAGCGGGAGCATGTGGCTGG - Intronic
1061088408 9:128412426-128412448 AGGGAGAGGGGAGCTGAGGCTGG - Intronic
1061849437 9:133405779-133405801 AGGGAGAGGGCACACGTGGAGGG - Exonic
1061907295 9:133705229-133705251 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907308 9:133705278-133705300 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907321 9:133705327-133705349 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907334 9:133705380-133705402 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907347 9:133705433-133705455 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907370 9:133705531-133705553 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1062418024 9:136463283-136463305 AGGGAGAGGGAACGTGCGGTTGG - Intronic
1202629303 M:3493-3515 AGGGTGATGGTAGATGTGGCGGG - Intergenic
1187579966 X:20596875-20596897 AGGGAGAGGCAAGAAGTGGAAGG + Intergenic
1187970287 X:24652025-24652047 AGGCAGAGGAAACATGTTGGAGG + Intronic
1189750401 X:44214974-44214996 TGGGAGAGGGAACTGGTGGGAGG + Intronic
1192135806 X:68599245-68599267 AGGGAGAGAGAACATGGTGAGGG - Intergenic
1195021000 X:100828465-100828487 AGGGAGAGAGAACATGTCAGTGG - Intronic
1195494249 X:105511520-105511542 ATGGAGAGGACACATGTGGGTGG - Intronic
1195713258 X:107792632-107792654 AGGCAGAGGGAACATGTGCAAGG - Intronic
1196134069 X:112188050-112188072 AAGGAGTGGGCACATGTGTCTGG - Intergenic
1196842199 X:119869227-119869249 AGGGAGATGGAACACGAGGCCGG - Intergenic
1197173134 X:123456564-123456586 AGGGAGGGGTAAGGTGTGGCTGG - Intronic
1197747915 X:129945304-129945326 AGGGAGAGATAGCATCTGGCTGG - Intergenic
1198888216 X:141362377-141362399 AGGGAGAGGGACCCTGGGCCAGG + Intergenic
1199577230 X:149324073-149324095 TGGGAGAGGGGACAGGTGGAAGG + Intergenic
1199850742 X:151723533-151723555 AGAGAGAGGAAACATGTCCCTGG + Intergenic
1201165528 Y:11205194-11205216 AGGGAGATGGCACCTGTGCCTGG + Intergenic
1201296161 Y:12464930-12464952 AGGAAGAGGAAACATGAAGCTGG - Intergenic
1202605074 Y:26632513-26632535 TGGAAGAGGGAACAGCTGGCAGG - Intergenic