ID: 1151243888

View in Genome Browser
Species Human (GRCh38)
Location 17:72779517-72779539
Sequence GTGTAGGATAAATCCTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151243883_1151243888 1 Left 1151243883 17:72779493-72779515 CCCAGACATCCTGGGACATGAGA 0: 1
1: 0
2: 2
3: 12
4: 177
Right 1151243888 17:72779517-72779539 GTGTAGGATAAATCCTTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 86
1151243882_1151243888 4 Left 1151243882 17:72779490-72779512 CCTCCCAGACATCCTGGGACATG 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1151243888 17:72779517-72779539 GTGTAGGATAAATCCTTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 86
1151243884_1151243888 0 Left 1151243884 17:72779494-72779516 CCAGACATCCTGGGACATGAGAG 0: 1
1: 0
2: 1
3: 20
4: 169
Right 1151243888 17:72779517-72779539 GTGTAGGATAAATCCTTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 86
1151243887_1151243888 -8 Left 1151243887 17:72779502-72779524 CCTGGGACATGAGAGGTGTAGGA 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1151243888 17:72779517-72779539 GTGTAGGATAAATCCTTTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151243888 Original CRISPR GTGTAGGATAAATCCTTTCC TGG Intronic
913144738 1:115977462-115977484 GTGAAGGACTAATCCTTGCCTGG - Intronic
1063337505 10:5230276-5230298 ATTTAGAATAAATCCCTTCCAGG + Intergenic
1063736795 10:8766146-8766168 GTGCTGGAAAAATCCTTTGCAGG + Intergenic
1064638842 10:17395328-17395350 CTGCAGGAGAACTCCTTTCCAGG + Intronic
1069343690 10:67441727-67441749 ATGAAGGAGAAATACTTTCCTGG + Intronic
1069628498 10:69882759-69882781 TGGTATGATAAAACCTTTCCTGG - Intronic
1070537936 10:77393295-77393317 GTGAAGAACAAATCCTTTTCTGG - Intronic
1070713217 10:78698612-78698634 GTTTAGGATAACTCCATTCAAGG + Intergenic
1074269161 10:111936029-111936051 GTGTAAGATAAATACTTTCATGG - Intergenic
1076347957 10:129793607-129793629 TTGCAGGATAAATCCTGCCCTGG + Intergenic
1078374396 11:10781448-10781470 CTGTAGCATATACCCTTTCCTGG - Intergenic
1081388346 11:42499830-42499852 GTTTAGGATAAAGTCATTCCAGG - Intergenic
1089807441 11:121104157-121104179 ATGAAGGATAAATCCATGCCAGG + Intronic
1090227897 11:125082632-125082654 GTGTAGGAGAAACCCCCTCCAGG + Intronic
1090365559 11:126202482-126202504 GTGTAGTATGTATCCTTTCTAGG - Exonic
1092578755 12:9817275-9817297 GTGTGAGCTAAATCCTTTACTGG - Intergenic
1101675453 12:106912998-106913020 GTCCAGGATAATTCCATTCCAGG - Intergenic
1106899501 13:34340380-34340402 GTGTTGTATGCATCCTTTCCAGG + Intergenic
1108123885 13:47219840-47219862 CTGTAGGAGAAATTTTTTCCTGG + Intergenic
1109097725 13:58140211-58140233 GACTAGAATAAATCCTTTTCTGG - Intergenic
1109830385 13:67778725-67778747 GTGAAGGATAAGTCCATTTCTGG + Intergenic
1109965709 13:69692014-69692036 ATGTTGGAAAAATCATTTCCAGG + Intergenic
1113068166 13:106392635-106392657 GTGTTTGTTAAATCCTTTTCAGG + Intergenic
1124588308 15:31031303-31031325 GAGTAGGAAAAAGCCTTCCCAGG - Intronic
1125328774 15:38563436-38563458 GTTTAGGTGAAATCCTCTCCAGG + Intronic
1128961334 15:72008269-72008291 GTGTAGGAAAAAAGCATTCCTGG - Intronic
1134287936 16:12878871-12878893 GTTTAGGATAAATGCATCCCTGG + Intergenic
1138403144 16:56765507-56765529 GTTGAAGAGAAATCCTTTCCTGG + Intronic
1141299749 16:82802979-82803001 GGGTTGGATGAATCCATTCCAGG - Intronic
1144931840 17:18865336-18865358 GTTTACCATAAAACCTTTCCCGG - Intronic
1147269512 17:39258188-39258210 ATGTAGGAAAAATTCTTTACAGG - Intergenic
1151243888 17:72779517-72779539 GTGTAGGATAAATCCTTTCCTGG + Intronic
1158111894 18:53949361-53949383 GTGGTGGATAAATGCCTTCCAGG + Intergenic
1158210338 18:55042009-55042031 GAGAAGTATTAATCCTTTCCGGG + Intergenic
1160064825 18:75564912-75564934 TTGTACGATAAATCCTCCCCTGG - Intergenic
1160284460 18:77527929-77527951 GTTCAGGATAAAACCATTCCTGG + Intergenic
1168443536 19:56392198-56392220 GCCTAGAATAAAGCCTTTCCAGG + Intronic
936672704 2:114676812-114676834 GTGTAGGATAGATTCTTCTCTGG + Intronic
942965053 2:181882281-181882303 GTGTAAGATAAATCATATCTAGG - Intergenic
943105395 2:183540659-183540681 GTGGAGAATAAATGCTTTACAGG + Intergenic
943344543 2:186722961-186722983 TTGGACGATAAATCCTTTTCAGG + Intronic
943765130 2:191652586-191652608 TTGTAGCCTACATCCTTTCCTGG - Intergenic
945437694 2:209838512-209838534 TTGTAGGATAATGCATTTCCCGG + Intronic
947837330 2:233185044-233185066 GTTTAGGAAACACCCTTTCCGGG + Intronic
1172041781 20:32051513-32051535 GGGTAGGGTAAGGCCTTTCCAGG + Intergenic
1173934616 20:46850514-46850536 GTGCAGGACAAATCCTGCCCTGG + Intergenic
1177890807 21:26801742-26801764 GTGAAGGAAAATCCCTTTCCTGG - Intergenic
951937931 3:28042712-28042734 GTGTATGATAATTCAATTCCTGG + Intergenic
952018226 3:28985102-28985124 GTGTGGGATAAATGCTTTATAGG + Intergenic
954780988 3:53060280-53060302 AAGTAGGATACATCATTTCCAGG - Intronic
955023895 3:55148436-55148458 GTGTAGAATAACTCCATTCCTGG - Intergenic
956499310 3:69864840-69864862 GTATAGAAAAAATGCTTTCCAGG - Intronic
962723255 3:138196063-138196085 GTGTTCGATAATTACTTTCCAGG - Intronic
966531246 3:180983335-180983357 ATGCAGGATAAATTATTTCCAGG - Intergenic
967064871 3:185905929-185905951 GTGTAAGAGAAAGCCTTTCATGG - Intergenic
970378094 4:15479307-15479329 GTGCAGGGTAAATCTTTTCAAGG + Intronic
982248638 4:153381441-153381463 TTGTAGAATAAATCTTTTCAAGG - Intronic
991662373 5:68963012-68963034 GTGAAGTTTAAAACCTTTCCCGG + Intergenic
993233660 5:85273852-85273874 GTGTAGGATAAATAATTGCTAGG + Intergenic
994839602 5:104905749-104905771 GTGAAGAATTACTCCTTTCCTGG - Intergenic
999498710 5:152125468-152125490 GTGTAGCATATCCCCTTTCCAGG - Intergenic
1002549795 5:179979103-179979125 GGGTAGGTTAAATCCGCTCCAGG + Intronic
1007027199 6:38588291-38588313 GTGCAGGATAATTGCTTGCCTGG - Intronic
1007988558 6:46231835-46231857 GTGTAGAGTAAAGGCTTTCCTGG + Intronic
1010756140 6:79668187-79668209 TTGTAGGATTACTTCTTTCCCGG - Intronic
1011140555 6:84150962-84150984 GTGTATGATTAATCCTTTCTTGG + Intronic
1012195787 6:96340471-96340493 ATGTAGGACAGATCCTTTCTAGG - Intergenic
1013936868 6:115606788-115606810 CAGTAGGATAAATGTTTTCCTGG - Intergenic
1014563387 6:122918006-122918028 GTGTGCCAAAAATCCTTTCCTGG + Intergenic
1017599756 6:156067846-156067868 GTGTAGGAAAACTCCTAGCCTGG - Intergenic
1022183428 7:27943639-27943661 GTGTGGGCTAATTTCTTTCCAGG + Intronic
1023497466 7:40813943-40813965 GTGAAGGGAAAATCTTTTCCGGG - Intronic
1024897513 7:54277791-54277813 CTGTAGGATAATTTGTTTCCTGG - Intergenic
1032899796 7:136294452-136294474 GTTTAGCAAAAATCCTTTCATGG + Intergenic
1035623460 8:1052529-1052551 GTGTAGGAGGAATCCTTTGACGG + Intergenic
1036924422 8:12891036-12891058 GTGTAGAATAAAGACATTCCAGG - Intergenic
1038401136 8:27285791-27285813 GGGTGGGATAAATACTTTACAGG + Exonic
1038587450 8:28802619-28802641 GCGTAGGATGGATACTTTCCAGG + Intronic
1041610024 8:59835105-59835127 GTGTAGGACAAATACATTTCAGG - Intergenic
1046389970 8:113557948-113557970 TTGTGGTATAAAACCTTTCCTGG - Intergenic
1047446943 8:124928097-124928119 GAGAAGGAGAAACCCTTTCCAGG + Intergenic
1047953264 8:129953283-129953305 GTGCAGGACAAGTCCTTCCCTGG - Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1059000992 9:110348709-110348731 GTCTAGGAAAAATCCTCTTCTGG + Intergenic
1185561080 X:1061099-1061121 GTTTAGCATAAATTCCTTCCTGG + Intergenic
1194083732 X:89500172-89500194 AAATAGGATAAATGCTTTCCAGG + Intergenic
1195230768 X:102844684-102844706 ATGTAGGATAAAAATTTTCCAGG + Intergenic
1199616692 X:149661416-149661438 TTGTAGGAAACTTCCTTTCCGGG - Intergenic
1199625949 X:149741832-149741854 TTGTAGGAAACTTCCTTTCCGGG + Intergenic
1200436379 Y:3156049-3156071 AAATAGGATAAATGCTTTCCAGG + Intergenic