ID: 1151244863

View in Genome Browser
Species Human (GRCh38)
Location 17:72786670-72786692
Sequence GCTTCTGTATGGGCAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151244859_1151244863 30 Left 1151244859 17:72786617-72786639 CCTCAATGACAGGGAGTTCACAC 0: 1
1: 0
2: 2
3: 9
4: 125
Right 1151244863 17:72786670-72786692 GCTTCTGTATGGGCAGGAAGTGG 0: 1
1: 0
2: 0
3: 26
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151244863 Original CRISPR GCTTCTGTATGGGCAGGAAG TGG Intronic
900972576 1:5999742-5999764 GACTCTGTATGGTCAGGAACAGG - Intronic
903153787 1:21430617-21430639 GGCTCTGTATGGCCAGGAACTGG + Intergenic
903180687 1:21603428-21603450 GCTTCTCTGGAGGCAGGAAGGGG + Intronic
905429574 1:37911698-37911720 GCTGTTATATGGGCAGAAAGAGG + Intronic
906665185 1:47616339-47616361 GCATCTGCATGCACAGGAAGTGG + Intergenic
907372483 1:54012277-54012299 GCTCCTGAATGGGCAGGGAAAGG + Exonic
909729783 1:78876871-78876893 GCTGTTGTATGGGCTGAAAGAGG + Intergenic
911469354 1:98297918-98297940 GTTTCTGTAGGGGCTGAAAGAGG + Intergenic
912508301 1:110171667-110171689 GCTTCTCTGTGGTCAGGAGGGGG + Intronic
914435249 1:147653919-147653941 GTTTGTGTTTGGGCAGGCAGGGG - Intronic
914984703 1:152446483-152446505 GATGCTGTCTGGCCAGGAAGAGG + Intergenic
915006752 1:152645361-152645383 GCTCCAGTAAGAGCAGGAAGTGG + Intergenic
915170277 1:153972782-153972804 GCGTCTGCTGGGGCAGGAAGGGG + Exonic
916299797 1:163261317-163261339 CTTTATGTATGAGCAGGAAGGGG - Intronic
917713392 1:177710024-177710046 GAGTATGTATGGGCAGGCAGTGG - Intergenic
918288288 1:183080425-183080447 GCTTCTGAAGTGGCAGGATGGGG + Intronic
919350135 1:196440993-196441015 GCTTCTTTCTGAGCAGGATGAGG - Intronic
919772791 1:201173392-201173414 GCTTCTGGAGGAGCAGGAAGAGG - Intergenic
920969285 1:210729084-210729106 GCTTCTATTTGGGCAGAAAAGGG + Intronic
921939337 1:220824134-220824156 GCTTCTCTATGGGGTGGAACTGG + Intergenic
922368801 1:224889651-224889673 GCTGTTATATGGGCAGAAAGAGG + Intergenic
923400061 1:233608128-233608150 GGGCCTGTGTGGGCAGGAAGAGG + Intergenic
1063372906 10:5533344-5533366 GCATCAGGATGGGTAGGAAGTGG - Intergenic
1063584701 10:7341458-7341480 GCTTTTGTTTGGAGAGGAAGAGG + Intronic
1063865446 10:10360280-10360302 GCTTAAGTTTGGGCAGAAAGGGG + Intergenic
1065782227 10:29180569-29180591 ATTTTTGAATGGGCAGGAAGTGG - Intergenic
1067820421 10:49524099-49524121 GCTTCTGTAGGAGAAGGAGGAGG - Exonic
1068049785 10:51935081-51935103 GCTACCCCATGGGCAGGAAGAGG - Intronic
1069077671 10:64055029-64055051 ACTCTTGGATGGGCAGGAAGGGG + Intergenic
1069615039 10:69801658-69801680 GGTTATTTATAGGCAGGAAGGGG - Intergenic
1070114943 10:73519315-73519337 GCTTCTTTATGGTCAGGACTAGG - Intronic
1071206905 10:83290465-83290487 GCTAGTGAATGGGCAAGAAGAGG - Intergenic
1073395025 10:103210472-103210494 GCTGTTATATGGGCAGAAAGAGG + Intergenic
1074102927 10:110367820-110367842 ACTTCTCTATGGGGAGAAAGAGG + Intergenic
1074265553 10:111899548-111899570 GCTTCTGTGTGAACAGGAATAGG - Intergenic
1075041820 10:119114068-119114090 GCCTCCTTCTGGGCAGGAAGTGG - Intronic
1076071681 10:127495412-127495434 GCAGCTGTATGGGAATGAAGAGG - Intergenic
1076499934 10:130929359-130929381 GCATCTGGATGGGCAGAAGGAGG - Intergenic
1076519652 10:131073644-131073666 CCCTCTGGATGGGCAGGATGTGG + Intergenic
1076548796 10:131264132-131264154 GCTTCTGGCTGGGCAGGACTTGG - Intronic
1076669091 10:132109742-132109764 GCTTCTGTGTGGTCAGAAACAGG + Intronic
1080443009 11:32312852-32312874 GCTTATCAATGGCCAGGAAGAGG + Intergenic
1081933531 11:46889118-46889140 CCTTCTCTATAGGCAGCAAGAGG - Intronic
1083273611 11:61584867-61584889 CCTTCTGTAGGGGCTGGAAGGGG - Intergenic
1083673199 11:64311361-64311383 GCTGTGGTATGTGCAGGAAGGGG + Intronic
1083911595 11:65713126-65713148 GCTCCTGGATGGGCAGGAGGCGG + Intronic
1084562680 11:69913368-69913390 GCTTCTGTGAGGGCAGGAGCAGG - Intergenic
1084603137 11:70158463-70158485 GTTTCTGTATCAGCAGGAGGGGG - Intronic
1084754214 11:71224540-71224562 GCTTGTGTTTGGGTGGGAAGAGG - Intronic
1084813426 11:71630255-71630277 CCTTCTGCATGTCCAGGAAGAGG + Intergenic
1084961826 11:72720917-72720939 CCTGCTGTCTGGGCAGGAGGTGG + Intronic
1085570544 11:77554450-77554472 GCTGTTATATGGGCAGAAAGAGG + Intronic
1085856456 11:80181507-80181529 GCTGCAGTATGGGGAGGGAGTGG + Intergenic
1086106973 11:83157215-83157237 GCTTCTGTGGCGGCTGGAAGTGG + Exonic
1086133382 11:83422848-83422870 GCTGTTATATGGGCAAGAAGAGG + Intergenic
1086970532 11:93075945-93075967 GCTGCTAGATGGGCAGAAAGCGG - Intergenic
1087203130 11:95365968-95365990 GTTTCAGAATGGGCAAGAAGAGG + Intergenic
1088327097 11:108612152-108612174 TTTTCTTTATGGACAGGAAGGGG - Intergenic
1089836341 11:121373884-121373906 GCTTCTGCATTGGCAGAGAGCGG - Intergenic
1090082561 11:123623772-123623794 GCATGTGTTTGGGCAGGAAAAGG + Intronic
1091605631 12:1949160-1949182 GGCTCTGTATGGGCAGGAGGAGG + Exonic
1095806434 12:46325241-46325263 GCTGTTATATGGGCAGAAAGAGG - Intergenic
1096159493 12:49365190-49365212 TACTCTGTATGGGAAGGAAGGGG + Intergenic
1097592656 12:61591066-61591088 GCTGTTATATGGGCAGAAAGAGG + Intergenic
1102181000 12:110912217-110912239 GCTTCTGTATGAGCAAGCAATGG - Intronic
1102253502 12:111403488-111403510 GCTGCTGTCTGGGCAGTGAGAGG + Intergenic
1102526502 12:113515848-113515870 GCTTCTAAATGGGCAAGAACGGG - Intergenic
1102612804 12:114127512-114127534 GCTTCTGTCAGGGCAGGTAGGGG + Intergenic
1102857476 12:116306824-116306846 GTTTCTGTTAGGACAGGAAGTGG - Intergenic
1103477971 12:121232559-121232581 GTTTCTGCAGGGGCAGGGAGAGG - Intronic
1104004240 12:124880975-124880997 GCTCCTGTTTGGGCAGGGATGGG + Intronic
1104391513 12:128394414-128394436 GCTTCTTTACAGGCAGGAAAGGG + Intronic
1105727963 13:23184644-23184666 GTTTCTGGATGGCCAGTAAGGGG + Intronic
1106434884 13:29714578-29714600 GCTTCTGGCTGGGCAGGTCGGGG - Intergenic
1106574158 13:30958619-30958641 GGTTCTGTTGGGGCAGGAAAAGG - Intronic
1111732949 13:92099962-92099984 GCTTCTTTATGGTCAGCACGAGG - Intronic
1112398499 13:99055394-99055416 GATTCTGTGTGAACAGGAAGTGG + Intronic
1112964440 13:105169657-105169679 GATTGTGTATGGGCAGGATGTGG + Intergenic
1113692791 13:112323639-112323661 GAATCTGCAGGGGCAGGAAGCGG - Intergenic
1116243548 14:42379097-42379119 GCTTCAGTGTGGGGAGGGAGTGG - Intergenic
1116263010 14:42654807-42654829 GCTTCTGCATTGGCAGAGAGTGG + Intergenic
1117160272 14:52982783-52982805 TCATCTGTGTGGGCAGGCAGAGG + Intergenic
1117252596 14:53951937-53951959 GCTTCAGTCTGGGGAGGAGGAGG - Exonic
1118680260 14:68234052-68234074 GCTGCTGTATAGTCTGGAAGTGG + Intronic
1120646707 14:87082871-87082893 GCTTATGTATGAGGAGGAGGAGG - Intergenic
1121192962 14:92046072-92046094 GCTGTTATATGGGCAGAAAGAGG - Exonic
1121891005 14:97590501-97590523 GCTTATGCATGGGCAGGAATTGG + Intergenic
1122896052 14:104757573-104757595 GCTTCAGCATGGGCAGGAGTGGG + Intronic
1123110443 14:105864652-105864674 GTTTATGTCTGGGCAGGAACAGG - Intergenic
1123160889 14:106277006-106277028 GCTTCTGTAGGGGAGGGATGTGG + Intergenic
1123208610 14:106737570-106737592 GCTTCTGTAGGGGAGGGATGTGG + Intergenic
1202938959 14_KI270725v1_random:124282-124304 GCTTGTGATTGGGCATGAAGTGG + Intergenic
1123481904 15:20639913-20639935 GCTTCTGTAGGGGAGGGATGTGG + Intergenic
1123508027 15:20965071-20965093 GCTTCTATATGTACAGAAAGAGG + Intergenic
1123565245 15:21538813-21538835 GCTTCTATATGTACAGAAAGAGG + Intergenic
1123601508 15:21976100-21976122 GCTTCTATATGTACAGAAAGAGG + Intergenic
1123636109 15:22360452-22360474 GCTTCTGTAGGGGAGGGATGTGG - Intergenic
1124129197 15:26970125-26970147 GTTTCTGGATAGGCATGAAGTGG - Intergenic
1124212982 15:27778674-27778696 GCTGCTGTGTGGGAAGGACGAGG - Intronic
1124355643 15:28993016-28993038 GCCCCTGGAGGGGCAGGAAGAGG + Intronic
1127708331 15:61568929-61568951 CCTTCTGGATGTTCAGGAAGTGG - Intergenic
1128391536 15:67185901-67185923 GCTACTCAGTGGGCAGGAAGGGG - Intronic
1128562678 15:68678942-68678964 GCTGCTGGAGGGGCAGGGAGGGG - Intronic
1129159627 15:73740122-73740144 GCCTCTGTATGGGCAGGCTCAGG + Exonic
1129259705 15:74358040-74358062 GCTGTTGTATGGGCTGAAAGAGG + Intronic
1131123572 15:89838848-89838870 GCTGGTGTATGGGCAGGTATGGG + Intronic
1131291257 15:91108972-91108994 GATTCTGTATGGGTTGGCAGGGG + Intronic
1132390578 15:101435446-101435468 GTTTCTGTTTGGGCTAGAAGTGG - Intronic
1202973616 15_KI270727v1_random:265919-265941 GCTTCTATATGTACAGAAAGAGG + Intergenic
1133128445 16:3662048-3662070 GCTGCTGCATGCGCAGGAAGTGG + Exonic
1133727198 16:8548654-8548676 ACTTCTCTATGGGCAAGAAAAGG - Intergenic
1135852559 16:25977795-25977817 GCTCCTGTGTGGGGACGAAGTGG + Intronic
1135895357 16:26396158-26396180 TCCTCTGTATGGGCAAGAATTGG + Intergenic
1135959876 16:26986630-26986652 GCTTCTGGAGGAGGAGGAAGAGG + Intergenic
1136067539 16:27768991-27769013 CCTGCTCTATGGGCAGGGAGGGG - Intronic
1136561923 16:31044305-31044327 GCGTGTGTATGTGCTGGAAGAGG + Intergenic
1136849138 16:33599824-33599846 GCTTCTTTAGAGGGAGGAAGAGG + Intergenic
1138412187 16:56849468-56849490 GCTTCTGTTTGAACAGGAAGTGG + Intronic
1139164380 16:64548739-64548761 GGTTCTGTAGGAGGAGGAAGGGG - Intergenic
1142147633 16:88499165-88499187 GCTTCTGTATGGCCAGGGCTGGG - Intronic
1203110845 16_KI270728v1_random:1448474-1448496 GCTTCTTTAGAGGGAGGAAGAGG + Intergenic
1144051914 17:11504163-11504185 GCTTGTATATGAGGAGGAAGAGG + Intronic
1145102447 17:20088345-20088367 GCTGCTGAATGGGCATTAAGTGG + Intronic
1146104151 17:30015645-30015667 CCATCTTTATGGGCATGAAGTGG + Intronic
1146737979 17:35255854-35255876 ACCTCTGTTTGGGGAGGAAGAGG - Intronic
1148206134 17:45781427-45781449 GCTGCTGGCTGGACAGGAAGGGG + Intergenic
1148876747 17:50692162-50692184 GCTTCTCTCTGGGCAGGAGGTGG - Exonic
1149409771 17:56393362-56393384 GGTTCTGTATGGGTGGGAGGTGG - Intronic
1150285474 17:63951504-63951526 GCACCTGTATGGTCAGGTAGGGG + Exonic
1151018731 17:70587689-70587711 CCTGCTGTTTTGGCAGGAAGTGG + Intergenic
1151244863 17:72786670-72786692 GCTTCTGTATGGGCAGGAAGTGG + Intronic
1151612412 17:75184850-75184872 GGTTCTCTTTGGGGAGGAAGAGG + Intergenic
1151802729 17:76387334-76387356 CCTTCTCCATGGCCAGGAAGAGG - Exonic
1155892479 18:31286244-31286266 GCTGTTATATGGGCAGAAAGAGG - Intergenic
1156270019 18:35522035-35522057 GCTGCTGGAGTGGCAGGAAGGGG + Intergenic
1156894526 18:42230203-42230225 GCTTAGGAATGGGGAGGAAGAGG + Intergenic
1157715177 18:49880077-49880099 GCTTCTGTATGGCCTTGAATAGG - Intronic
1158133875 18:54184268-54184290 GCCTCTGATTGGGCAGGAGGTGG - Intronic
1158290671 18:55938341-55938363 GATGCAGTATGGGCTGGAAGTGG - Intergenic
1158759455 18:60367560-60367582 GCTTCTTTATGGTGAGGAAAAGG - Intergenic
1159022360 18:63154254-63154276 GCTTCTGTAAGACCAGAAAGAGG - Intronic
1159429399 18:68332102-68332124 ACTTCTGTAAGTGAAGGAAGGGG - Intergenic
1159521921 18:69537124-69537146 ACTTCTGTATTGGCCGGATGAGG - Intronic
1159834171 18:73316269-73316291 GATTCTGTACGTGCAGGGAGGGG - Intergenic
1160196250 18:76758087-76758109 GCCTCTGCGTGGGCAGGACGGGG + Intergenic
1160907063 19:1456434-1456456 GCAGCTGTCTGGGCTGGAAGGGG + Intronic
1161315491 19:3615418-3615440 GGTTCGGCATGGGCAGCAAGGGG - Intronic
1161713845 19:5864580-5864602 CCTTGTGGATGGGCAGGGAGAGG - Intergenic
1162273844 19:9637690-9637712 GCTATTATATGGGCAGGAAAAGG - Intronic
1162841146 19:13357368-13357390 GCTTCTCTATGTACAGGAGGAGG + Intronic
1165067721 19:33238893-33238915 AGTTCTGTGTGGGCAGGAGGTGG - Intergenic
1165068499 19:33242035-33242057 GGGTCTGTATGGGCAGGAGGTGG - Intergenic
1165825517 19:38703603-38703625 GCTGCTGTGTTGTCAGGAAGGGG - Intronic
1166069901 19:40380937-40380959 GCTGCTGCATGGACACGAAGGGG + Exonic
1167777642 19:51571366-51571388 GGTTCTGTAGGGTCAGGAAGGGG + Exonic
1168718873 19:58544160-58544182 GCTTCTGTGTGGTCTGGAGGTGG + Intronic
925043550 2:752870-752892 TGTTCTGTTTGGTCAGGAAGAGG + Intergenic
925096910 2:1212598-1212620 GATTTAGTATGGGCAGGAAAGGG + Intronic
925199633 2:1956982-1957004 GGCTCTGTGTGAGCAGGAAGGGG + Intronic
925956955 2:8976032-8976054 GCTGTTGTCTGGGGAGGAAGAGG - Intronic
926304284 2:11626886-11626908 GTTTCTGTTTGAGCAGGCAGGGG + Intronic
926594168 2:14772010-14772032 ACTTCTATATGGGCAGGTATGGG - Intergenic
928199718 2:29239880-29239902 GCTGCTGGGTTGGCAGGAAGGGG - Intronic
928333572 2:30376578-30376600 GTTTCTGTAAGAGCAAGAAGTGG - Intergenic
928363614 2:30685279-30685301 GCGTCTGAGTGGGCAGAAAGGGG + Intergenic
929522620 2:42668085-42668107 GGTTATGGATGGGCAGGAAGAGG + Intronic
933190108 2:79324819-79324841 GCTTAGGAATGGACAGGAAGTGG - Intronic
933415460 2:81981951-81981973 GTTTTTGTAGTGGCAGGAAGAGG - Intergenic
935217175 2:100983491-100983513 GCCTGTGCAGGGGCAGGAAGGGG - Intronic
935350149 2:102145494-102145516 GCTCCTGGATGTGCATGAAGAGG - Intronic
935714829 2:105930702-105930724 GCCTCTGTCTGGGGAGGAGGGGG + Intergenic
936514939 2:113175400-113175422 CTTTCTGTGTGGGCAGGATGTGG + Intronic
937624718 2:124030819-124030841 GTTTCTGTATGTGTAGGAAAGGG - Intronic
937872503 2:126796258-126796280 GCTGCTATGTGGGCAGGGAGAGG - Intergenic
938063034 2:128267058-128267080 GGCTCTGTATGGCCAGGAACTGG - Exonic
940759822 2:157725667-157725689 GCTGCTGTTTGGCCAGGAAAAGG - Intergenic
944251379 2:197582685-197582707 GCTGTTATATGGGCAGAAAGAGG + Intronic
946034519 2:216731211-216731233 GGTTCTCTGCGGGCAGGAAGAGG - Intergenic
947598797 2:231431766-231431788 GCTGTTATATGGGCAGAAAGAGG - Intergenic
948647156 2:239412581-239412603 GCTTCTGCCTGGCCAGGAGGAGG + Intergenic
948844411 2:240676367-240676389 GCTTCTGGAGGGGCAGGCAAGGG - Intergenic
948849449 2:240698512-240698534 GCTTCTGGAGGGGCAGGCAAGGG + Intergenic
1168942986 20:1729266-1729288 GCTATTATATGGGCAGAAAGAGG - Intergenic
1169813128 20:9629114-9629136 GCCTCTGGATGGGAAGGCAGTGG + Intronic
1172291423 20:33779913-33779935 GCTTGTGAATGGGCAAGATGTGG + Intronic
1173825369 20:46044698-46044720 GCTTCTGTAAGGGAATGCAGTGG + Intronic
1174397672 20:50257987-50258009 GCCTCTCTATGAGCAGGGAGGGG + Intergenic
1175419500 20:58822416-58822438 GGTTGTCTATGGACAGGAAGAGG + Intergenic
1175537411 20:59724430-59724452 GCATCTGAATGGGGAGGAATAGG + Intronic
1175605475 20:60308814-60308836 GATGCTGTATGGGGTGGAAGGGG - Intergenic
1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG + Intronic
1179182639 21:39058816-39058838 GCTTCTGTGTGGGCCGGGCGCGG + Intergenic
1179658874 21:42862252-42862274 TCTGCTGGAGGGGCAGGAAGGGG + Intronic
1180267108 22:10540151-10540173 GCTTGTGACTGGGCATGAAGTGG - Intergenic
1182503684 22:30766752-30766774 TCTTCCATATGGCCAGGAAGGGG + Intronic
1183071535 22:35399919-35399941 ACTTCTGGCTGGGAAGGAAGTGG - Intergenic
1183635309 22:39058589-39058611 GCTGTTATATGGGCAGAAAGAGG - Intronic
1184467369 22:44676795-44676817 CCTTCTGTCCGGGCAGGAAGGGG + Intronic
1184866367 22:47203843-47203865 GCTTCTGTGCGGGAGGGAAGGGG - Intergenic
1184873327 22:47256233-47256255 GCTGCTGCATCAGCAGGAAGTGG + Intergenic
1184986694 22:48140739-48140761 CCTGCTGTGTGGGCAAGAAGCGG + Intergenic
1203288319 22_KI270735v1_random:5595-5617 GCTTGTGACTGGGCATGAAGTGG + Intergenic
951108303 3:18771085-18771107 GATTCTGTGTGGGCTGGAAGAGG - Intergenic
951912571 3:27767127-27767149 CTTTCTGAATGGGCAGGAAGAGG + Intergenic
952576726 3:34783025-34783047 GCATGTGTTTGGGTAGGAAGGGG - Intergenic
953656212 3:44856817-44856839 GCTGTTATATGGGCAGAAAGAGG - Intronic
954686590 3:52373346-52373368 GCTGCTGCGGGGGCAGGAAGCGG + Intronic
957451738 3:80389067-80389089 GCTGTTATATGGGCAGGAAGAGG + Intergenic
957675031 3:83355122-83355144 GCTGTTATATGGGCAGAAAGAGG - Intergenic
958422288 3:93942329-93942351 GCTGTTATATGGGCAGAAAGAGG + Intronic
958676507 3:97274484-97274506 GCTGTTGTATGGGCTGAAAGAGG - Intronic
958751324 3:98195554-98195576 GCTGTTGTATGGGCAGAAAGAGG + Intronic
959323733 3:104909945-104909967 GCTTCTGAAGTGACAGGAAGTGG - Intergenic
959535556 3:107481223-107481245 TCATCTGTATGGCCAAGAAGAGG - Intergenic
959586399 3:108028984-108029006 ACTTCTGTATGGGTCAGAAGAGG - Intergenic
960970950 3:123139884-123139906 GGCTCTGTATGTGCAGGCAGGGG - Intronic
961799691 3:129437660-129437682 GATTTTGTCTGGGCAGGTAGTGG - Intronic
964428280 3:156576321-156576343 GCTGCTAGATGGGAAGGAAGAGG + Intergenic
965335448 3:167427174-167427196 GCTGTTATATGGGCAGAAAGAGG + Intergenic
966399002 3:179529097-179529119 GATTCTGTAAGAGCAGGGAGTGG - Intergenic
967479558 3:189958138-189958160 GCATCTGTCTGGGGATGAAGAGG - Intronic
967893195 3:194377838-194377860 GGTTCAGTGTGGGCAGGAACCGG + Intergenic
968529383 4:1082684-1082706 GCTTCTGTGTGGGGAAGAGGAGG - Intronic
968942368 4:3645410-3645432 GCTTCTCTATGTGCGGGGAGAGG - Intergenic
971258152 4:25031775-25031797 GCTCCTGGCTGGGCAGGATGGGG + Intergenic
971944391 4:33255255-33255277 GCTTCTGAATGGGTAAGAGGTGG + Intergenic
974723752 4:65773690-65773712 GCTTCAGTATAGGGAGGAAGTGG + Intergenic
974904123 4:68035188-68035210 GCTGTTATATGGGCAGAAAGAGG + Intergenic
976148076 4:82063234-82063256 GCAGGTATATGGGCAGGAAGGGG - Intergenic
976216960 4:82724537-82724559 ACTTATTTGTGGGCAGGAAGAGG - Intronic
980315402 4:131192838-131192860 GCTTCAGTCTGGGCAGCAGGTGG + Intergenic
980891693 4:138822459-138822481 GCTTCTGGATGGGGAAGAACTGG - Intergenic
980928243 4:139159853-139159875 GCTGTTATATGGGCAGAAAGAGG - Intronic
982178680 4:152730045-152730067 ACTACTGTAGGGACAGGAAGAGG + Intronic
983474290 4:168195698-168195720 ACATCTGTATGGGCATGGAGTGG - Intergenic
984412047 4:179407568-179407590 GCTGTTATATGGGCAGAAAGAGG + Intergenic
985195353 4:187422943-187422965 GCTTCTTCATGGGCAGAAACAGG - Intergenic
985488110 5:163120-163142 GCTTCTGTGTGGACAGGACGGGG + Exonic
987141748 5:14953528-14953550 TCTTCTGTAAGAGCAGGAATGGG + Intergenic
987193870 5:15505532-15505554 GCTTATGTGTTGGGAGGAAGGGG + Intronic
988192998 5:27963822-27963844 GCTGCAGTGTGGGTAGGAAGTGG + Intergenic
989176938 5:38537240-38537262 GCTGCGGTATGGAGAGGAAGGGG - Intronic
990537488 5:56737018-56737040 GGTGCTGTATGGGCTGGAAGAGG - Intergenic
991577717 5:68122362-68122384 GCTGCAGTATGGGGAGGGAGAGG - Intergenic
992772474 5:80061107-80061129 CTTTCTGAAAGGGCAGGAAGTGG + Intronic
994125813 5:96168394-96168416 GCTGTTGTATAGGCAGAAAGAGG - Intergenic
995695584 5:114875420-114875442 GCTTCTGTTGGAGCAGGGAGGGG + Intergenic
996021488 5:118595644-118595666 GCATTTGTATGAGCTGGAAGAGG - Intergenic
996725488 5:126670283-126670305 GCTGTTATATGGGCAGAAAGAGG - Intergenic
996978898 5:129465670-129465692 GCTGCTGTCAGGGCAGGAATGGG + Intronic
997157651 5:131576440-131576462 GCTGTTATATGGGCAGAAAGAGG + Intronic
999053716 5:148551198-148551220 GCTTCTGCATGGGCTGGAATGGG - Intronic
999540661 5:152568743-152568765 GCTTATGTTTGGGCAAGAATAGG + Intergenic
999977570 5:156927104-156927126 GCTGCTGGAAGGGCAGGTAGAGG + Intronic
1002798944 6:502908-502930 GGTCCTGTGTGGACAGGAAGTGG + Intronic
1003474048 6:6465137-6465159 GCTGCTGCATGGGCAGGGAAGGG + Intergenic
1004166573 6:13262076-13262098 CATTCTGTATGGGCTGGAGGAGG + Intronic
1006081502 6:31570201-31570223 ATTTCTGTAGGGGCAGAAAGGGG - Intergenic
1006923768 6:37643001-37643023 GCTTCTTTGTGGGCAGTGAGAGG - Intronic
1007098869 6:39231033-39231055 GCCTCTGTAGGGGCAGGTACTGG + Intergenic
1008249822 6:49226329-49226351 GCTTCTGCACAGGCAGGATGTGG - Intergenic
1008356537 6:50560718-50560740 GCTACTGTATATGCAGAAAGAGG + Intergenic
1011259150 6:85453698-85453720 GCAGCCTTATGGGCAGGAAGTGG - Intronic
1012910059 6:105108177-105108199 TCTTCTTTGTGAGCAGGAAGAGG - Intronic
1015894243 6:138001140-138001162 GCTTCTTTCTGGAGAGGAAGTGG - Intergenic
1016224423 6:141717541-141717563 ACTTCGGTTTGGGGAGGAAGGGG + Intergenic
1016997999 6:149974560-149974582 GGTTCTGTGCAGGCAGGAAGTGG + Intergenic
1017000274 6:149991660-149991682 GGTTCTGTGCGGGCAGGAAGTGG - Intergenic
1017819874 6:158041524-158041546 GCTCCAGTGTGGGCAGGGAGGGG + Intronic
1018336221 6:162792702-162792724 GCTTCTGTTAGAGCAAGAAGAGG + Intronic
1019009266 6:168828555-168828577 ACTTCTGTTTGGGAATGAAGAGG - Intergenic
1019928492 7:4208417-4208439 GTTTCTGGATGGGCAGGACTGGG + Intronic
1024443320 7:49446881-49446903 GCTTCTCTCTGGGGAGGAAAGGG + Intergenic
1025237875 7:57246797-57246819 GGTTCTGGATTGGCATGAAGTGG + Intergenic
1025796640 7:64744028-64744050 TCTCCTGTATGGGCATAAAGAGG - Intergenic
1026865012 7:73818360-73818382 GCTTCTGCTTGGGCAGTAAAGGG - Intronic
1026902860 7:74046609-74046631 CCTTCTGTCTGAGCAGAAAGTGG + Intronic
1028585740 7:92449164-92449186 GGTTCTCTATGGAAAGGAAGAGG + Intronic
1029579280 7:101424711-101424733 GCTGCTGTCTGGGCAGGGAGAGG + Intronic
1030428156 7:109406818-109406840 CCCTCTGTATGTGCAGGAAATGG - Intergenic
1030463799 7:109874508-109874530 GCATGTGCAGGGGCAGGAAGTGG + Intergenic
1031425199 7:121596786-121596808 CTTTCTGTTTGTGCAGGAAGTGG + Intergenic
1032331337 7:130983286-130983308 GCATCTATCTGGGCAGGAATTGG + Intergenic
1033109583 7:138562487-138562509 GCTTCTGTACTGGCAGGAGTGGG + Intronic
1033797966 7:144870263-144870285 GCTTGGGTATGTACAGGAAGAGG + Intergenic
1035238421 7:157515101-157515123 CCTGCTGTCTGGGCAGGGAGAGG - Intergenic
1037667659 8:20984197-20984219 GATCCTCTATGGTCAGGAAGGGG + Intergenic
1037892711 8:22631914-22631936 AATTCTGGAGGGGCAGGAAGCGG + Intronic
1038425360 8:27461010-27461032 TCTTCTGGAAGGGGAGGAAGCGG - Exonic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1039350524 8:36759085-36759107 GGCTTTGCATGGGCAGGAAGGGG - Intergenic
1041085186 8:54250133-54250155 CCTTCTGCATCTGCAGGAAGTGG + Intergenic
1043599177 8:81917862-81917884 GCTGTTGTATGGGCAAAAAGAGG + Intergenic
1044666835 8:94640842-94640864 GCTTCGGGAGGGGGAGGAAGGGG - Intergenic
1049068785 8:140340742-140340764 GCTACTGCATGTGTAGGAAGGGG - Intronic
1049325936 8:142021469-142021491 TCTTATGTCTGGGCAGGAACTGG - Intergenic
1049668219 8:143858268-143858290 CCTTCTGCATGGCCTGGAAGAGG + Exonic
1049668635 8:143859867-143859889 CCTTCTGCATGGCCTGGAAGAGG + Exonic
1049669050 8:143861469-143861491 CCTTCTGCATGGCCTGGAAGAGG + Exonic
1049669465 8:143863071-143863093 CCTTCTGCATGGCCTGGAAGAGG + Exonic
1049669875 8:143864664-143864686 CCTTCTGCATGGCCTGGAAGAGG + Exonic
1049670292 8:143866272-143866294 CCTTCTGCATGGCCTGGAAGAGG + Exonic
1049670648 8:143868246-143868268 CCTTCTGCATGGCCTGGAAGAGG + Exonic
1049671290 8:143871129-143871151 CCTTCTGCATGGCCTGGAAGAGG + Exonic
1049681260 8:143919461-143919483 CCTTCTGCATGGCCTGGAAGAGG + Exonic
1050674160 9:8033035-8033057 GTTTGTTTATGGGGAGGAAGAGG - Intergenic
1051260377 9:15258087-15258109 GCTGCTGTATGGAGAGTAAGTGG + Intronic
1051663351 9:19445678-19445700 GCTTGAGTATGGGCAGTGAGAGG + Intronic
1052194063 9:25690795-25690817 GCTTCTTCAAGGGCAGGAACAGG - Intergenic
1054924134 9:70571863-70571885 GCTTCTGTCAGAGCAGAAAGAGG + Intronic
1055464782 9:76553743-76553765 GCTTCTGTACAGGAAGCAAGAGG + Intergenic
1055988363 9:82077733-82077755 GCTTGTGGATAGGCAGGAAGAGG + Intergenic
1057437429 9:95055283-95055305 GCTAGTGTGTGGGCAGTAAGGGG + Intronic
1059521181 9:114943841-114943863 CCTTCTGTGTGTCCAGGAAGAGG + Intergenic
1060647072 9:125290028-125290050 GCTTCTGTTAGGTCAGGAAGAGG + Intronic
1061117237 9:128621847-128621869 GCTTCTGTGTGGGAGGGATGTGG - Intronic
1061797915 9:133099028-133099050 ACTGCAGTATGGGCAGGACGGGG - Intronic
1062611477 9:137376544-137376566 GCATCTCCATGGGCAGAAAGAGG - Intronic
1203614199 Un_KI270749v1:40777-40799 GCTTGTGACTGGGCATGAAGTGG - Intergenic
1189127080 X:38459989-38460011 GCTGCAGTATGGGAAGCAAGAGG + Intronic
1189881922 X:45503066-45503088 GCTGCTGTCTGAGAAGGAAGGGG - Intergenic
1192764174 X:74125619-74125641 GCTGTTATATGGGCAGAAAGAGG - Intergenic
1195737774 X:108031419-108031441 GCTCTGGTATGGCCAGGAAGTGG - Intergenic
1196626933 X:117887378-117887400 GCTGCTGCATGGTCAGGGAGGGG - Intergenic
1197592739 X:128428549-128428571 GCTATTGTTTGGGCAGGCAGAGG - Intergenic
1197638381 X:128941734-128941756 GATTCTGTATGTCTAGGAAGGGG - Intergenic
1202062312 Y:20900284-20900306 GCTGTTATATGGGCAGAAAGAGG + Intergenic